Transcript

hyou1-002

ID
ZDB-TSCRIPT-110325-624
Name
hyou1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049890 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049890|OTTDARG00000035102|ZDB-GENE-030131-5344 hyou1|no_translation hyou1-002 LG_ CU861448.11 Danio rerio protein_coding KNOWN, 734 bp
CTGGAAAAGAGCAGGATCAGCCAGAGAAGCAGGAAGAAAC
TGTCCAGGAGAAGCCAGAGACGGAGGAGGGAAAAGAAGCA
GAGCCTCAGGCCGAGGAGCAGAAAGAAGACAAAGAAAAAG
CTGAAAATCAGGGAGAAACTGAATCAGAGAAAACAGAAAA
ACCTGAAGAAAAAACAACCGATGAGGAGAAGGAGGCTGAC
ATGAAACCCAAACTGCAGAAAAAGAGCAAAATATCAGCAG
ACATTGCAGTGGAGCTGGAAGTGAACGATGTGCTGGATCC
CAGCACTGAGGACATGGAGGGTTCCAAGAAGAAGTTGCAG
GACCTCACTGACCGTGATTTGGAGAAGCAGGAGAGAGAAA
AGACCCTGAACAGCCTGGAGGCTTTTATCTTTGAGACGCA
GGATAAGCTGTATCAGGATGAGTATCAGGCTGTGGTGACA
GAGGAGGAGAAGGAGCAGATTTCAGGCAGGCTGAGCGAGG
CGTCCAGCTGGATGGATGAGGAGGGATACAGCGCAGGCAC
CAAACTGCTGAAGGAGAAGCTGTCTGAACTGAAGAAGCTT
TGTAAAGGCATGTTCTTCAGGGTGGAGGAGAGGAAGAAGT
GGCCCGACAGACTGGCAGCTCTGGACAGCATGCTCAACCA
CTCCAACATCTTCCTCAAGTGAGTGACAGCGCACCAGCCA
TCTCCTCTCACATCCTGTACATTTTATTTATTTAAATAAA
TATATTTAAACAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations