ZFIN ID: ZDB-TSCRIPT-110325-603
Transcript Name: ndp-201
Previous Names: ndp-001, ch211-222m21.5-001, si:ch211-222m21.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049781 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049781|OTTDARG00000035032|ZDB-GENE-060216-2 ndp|OTTDARP00000039054 CH211-222M21.5-001 LG_ BX572627.5 Danio rerio protein_coding NOVEL, 811 bp
AAACAGAGAAGAGAGCAAGTGGATGGGGGAGAGATCTAAA
GGCAATTGTTGCTTAAGAAATTTCATTTCTGTCCTAGAGG
AGCCAGCTGGGATTGGATATTGCAGGTTAAACGGAACCAG
GCTGAAGACACATCCAGACCACTCAAGGCGATGGCTGAGT
TTAACGAGTACGCTCAGATTCAGCTCACATATGTGCCATC
GATAACACAGCAAAGAGCTCTTCATTGTCTTCTGTAGGAG
ACGGTCAAGCTTTCTGTCGTTTTACCTGCAGACACTATGA
GGAACTCGGTCGCTCTGAGCCAGCCGGGCATTCTACTTCT
TCTGGTCACATGTCCTCTGCTGACTATCCTGCAGGGTGTC
ACCTGTAAGGCAGAGAGTGGACACTTAGGGGACAATGATC
CTGACAGGTGTATGAGACACCACTTTGTTGAGACCATCAC
ACATCCTATCTACAAGTGCAATTCAAAGATGGTCCTCCTG
GCTCGATGTGAGGGTCACTGTAGCCACACTTCTCGTTCAG
ACCCACTGATTTCTTTTAGCTCTGTCCTGAAGCAGCCTTT
CAAAAATACATGTTTCTGCTGCCGTCCACACACCTCCAAA
CTGAAGGCAGTACGTCTTCGATGCTCGGGTGGGACACGGA
TAACCGCTACTTACCGTTACATCCTTGCGTGCAGCTGTGA
GGAGTGCAGCTGAATGAATTTGTCATGGAGAAAGACCCTC
TGGGCTGAAACACACAAAAAAGTTTGAAGGTACACTTTAT
TGCTGATGATTCAGAGCAACCATTTTACGATTCATTAGCA
CTGCCGAAATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ndp-201 Contained in:
OTHER ndp-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049781 (1)
  • Ensembl_Trans:ENSDART00000149383 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT644194 (1) 811bp
    GenBank:CT642474 (1) 729bp
    GenBank:EB957391 (1) 692bp
    GenBank:EB893654 (1) 417bp
    CITATIONS (3)