ZFIN ID: ZDB-TSCRIPT-110325-478
Transcript Name: sox2-201
Previous Name: sox2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049317 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049317|OTTDARG00000034763|ZDB-GENE-030909-1 sox2|OTTDARP00000038694 sox2-001 LG_ FP102167.4 Danio rerio protein_coding KNOWN, 2072 bp
CTCTGGCGAGGAGGGAAACCGAGTTTGTGTTGATTCTTCA
AGACTAAGAAAAGAAGTTTGTGGGCACAACAGGACCTAAG
AGCGCTTCTTTTCCCAGCAAAGTTACCTCCAACTGCTAAG
GTAACTTCAGCAGCCTCTCCACACACTTTTTGGACTTCTT
TATTTTTTATTTTTACGGCTGGTGGGGTAGACTTTCGAGA
AAATCGGTTTAAATGTATAACATGATGGAAACCGAGCTGA
AGCCCCCGGCGCCCCAGCCCAACACCGGGGGCACGGGGAA
CACCAACTCCTCGGGAAACAACCAGAAAAACAGCCCGGAC
CGCATCAAGAGACCCATGAACGCCTTCATGGTGTGGTCGA
GGGGACAGCGGCGGAAAATGGCACAGGAGAACCCCAAAAT
GCACAATTCGGAAATAAGTAAGCGACTCGGGGCCGAGTGG
AAACTTCTGTCCGAGAGCGAGAAGCGACCATTCATCGACG
AAGCCAAACGCCTTCGGGCTCTGCACATGAAGGAACACCC
GGATTACAAATACAGACCCCGGAGGAAAACCAAGACCCTG
ATGAAGAAGGACAAGTACACCCTGCCGGGCGGGCTCCTGG
CGCCGGGCGGCAACGGCATGGGCGCCGGCGTGGGTGTAGG
GGCCGGTTTGGGCGCCGGGGTCAACCAGAGGATGGACAGC
TACGCGCATATGAACGGCTGGACCAACGGAGGCTACGGCA
TGATGCAGGAGCAGCTGGGTTACCCGCAGCACCCGAGTTT
GAACGCGCACAACACGGCGCAGATGCAGCCCATGCACCGC
TACGACATGAGCGCGCTCCAGTACAACTCCATGACCAACT
CGCAGACCTACATGAACGGCTCGCCCACCTACAGCATGTC
CTATTCGCAGCAAAGCACGCCGGGAATGACGCTGGGCTCC
ATGGGCTCGGTGGTCAAGTCCGAGTCTAGTTCGAGTCCGC
CGGTGGTCACGTCGTCGTCTCATTCCCGGGCCGGACAGTG
CCAAACGGGGGACCTGCGGGACATGATCAGTATGTACCTG
CCCGGGGCGGAGGTGCAGGACCAGAGCGCTCAGAGCAGAC
TGCACATGTCCCAACATTACCAGAGCGCACCTGTGCCCGG
TACGACGATTAACGGCACGATTCCCTTATCGCATATGTAA
AATGAACTCTTTTTACTACACTGCTGGACTATTTTTGTAC
AGAACACTTCTTTTGGGGAGGGAAAAAGTTGTATAGAGCT
CAAGGAAAGAACACAAAACTTTTGCTTTCTATTTAAAAAA
CAAACAAACAAACAAACAAACAAACTAAAAAAAAGAGGAA
CGGTAGGAACTCCACACAGTTTTTGTTTTGTTCTCTTCTG
ATTTATTTTATTATTTTTTTAATTTAGATTTTTCAGTTCT
GTTTTGTTTCCAAAAGGTGTATGAGATTTGGACATGGTTG
ACAAGCGGGGGGAGAATGAATCAAATGTTTTATTATTGCA
ATCGACTTTTTGTACAGTATTTATCTAAAAAAAGAAGCGT
AATAACAACAACGAGATGTAATGTTTGTAAACAGCAGAAA
GTTTTAAAAAAATTATAAAAAATTGTGCAAGAAATTGATG
CACAACTGATGTTTACGTCAAAGTTTTGCAAAGGCTGACA
TGAAAACTGGATTTAAAGAGTTTCTCACTGAAGGTACATA
GTAATAAATCATTATTATTATTATTATTATTATTATTATT
ATTATTATTATTATTATTATTAAGTTCTAAATGAGAGAAC
GAACAGAGGCACTCTCCAGCTTTTTTTAATTTCCACTTGA
TTATTTTCGGTCTCCCACTCTTCATCTGTTAGATATATGA
AGTTTGTGTTCTTTATTTTCTCATGGTTTGTAAATTTTCT
GTACATTTTCTGTGATATTTTAAGTTTTTATTTTAAAACT
TTCATTTTTCGTAGTTGTAAAATGTGGCCTGTACGCAGTT
GCCAACGCTCCATGTATATATTTTAACTAATAACATCATT
ATAACAGTTACAAGATGAGTTTTTTTTCCAATGCAGTTTG
AAATGAATAAATTTTTGAAATTTGGATATTTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sox2-201 Contained in:
[BAC] CH73-242D14 (1)

Genome Resources: Vega_Trans:OTTDART00000049317 (1),  Ensembl_Trans:ENSDART00000104493 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC065656 (1) 2120 bp
GenBank:BC056743 (1) 2094 bp
GenBank:AB242329 (1) 2072 bp
CITATIONS (2)