ZFIN ID: ZDB-TSCRIPT-110325-398
Transcript Name: srp9-201
Previous Name: srp9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049067 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049067|OTTDARG00000034640|ZDB-GENE-040426-1106 srp9|OTTDARP00000038503 srp9-002 LG_ BX255939.3 Danio rerio protein_coding KNOWN, 596 bp
GTTTACTAAACCATGCCTTATTATCAAACATGGGAAGAGT
TTGCGCGAGCTGCCGAAAAACTTTACTTGACGGACCCAAT
GAAGGTCAGAGTGGTGCTGAAATACAGACACTGTGATGGA
AATCTCTGTATGAAGGTCACAGATGATGCTGTTTACAAGA
CTGACCAGGCCCAAGATGTGAAGAAGGTTGAGAAACTGCA
TGGGAAACTGATGAGATTAATGGTCTCCAAAGAGACTCAC
AGTGGGTCAATGGAAACAGACTGAAGTCGTCAAATGAAAC
CGTTGGAATTGGACAGTTGTTTTTGACTCGGTCTGACTGA
CAATGAAGAGAGACTGATTTCTAGGAGGATCGAGAAGACG
TTTGGTTGATTGTTTTTTTGACTGATGTCCATATGCTCAT
GTGGAGAGCAAGCAGCCAGAGCATCTTACAAGGGGCTGAT
ATTTGTGTTATTCTGAAAGTTGGACAACGTTGTAATGGTC
ATACTGTTGTTTTCATTTGGTCTGCCTATTATTTAATGTT
TGGAGGACGTAGATTTTTAACTGCAACATCAAGGGATGAA
TTTCATAAGTCTGTATTTTGTATATCTAAGCCTGAT

srp9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA srp9-201 596
srp9-202 (1)    Ensembl 725
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srp9-201 Contained in:
[BAC] DKEY-5G7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049067 (1),  Ensembl_Trans:ENSDART00000062895 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT628487 (1) 601 nt
CITATIONS (2)