ZFIN ID: ZDB-TSCRIPT-110325-2213
Transcript Name: srp9-202
Previous Name: srp9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049066 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049066|OTTDARG00000034640|ZDB-GENE-040426-1106 srp9|OTTDARP00000038502 srp9-001 LG_ BX255939.3 Danio rerio protein_coding KNOWN, 725 bp
ATATTTTACGCCACCTGGGTTTTCCTTCAAACAGCTGTAA
TTTCCTTCGCCGTTAAAGTATTATTAAAATACATTATATA
CAGAGTTTACTAAACCATGCCTTATTATCAAACATGGGAA
GAGTTTGCGCGAGCTGCCGAAAAACTTTACTTGACGGACC
CAATGAAGGTCAGAGTGGTGCTGAAATACAGACACTGTGA
TGGAAATCTCTGTATGAAGGTCACAGATGATGCTGTTTGT
TTACAGTACAAGACTGACCAGGCCCAAGATGTGAAGAAGG
TTGAGAAACTGCATGGGAAACTGATGAGATTAATGGTCTC
CAAAGAGACTCACAGTGGGTCAATGGAAACAGACTGAAGT
CGTCAAATGAAACCGTTGGAATTGGACAGTTGTTTTTGAC
TCGGTCTGACTGACAATGAAGAGAGACTGATTTCTAGGAG
GATCGAGAAGACGTTTGGTTGATTGTTTTTTTGACTGATG
TCCATATGCTCATGTGGAGAGCAAGCAGCCAGAGCATCTT
ACAAGGGGCTGATATTTGTGTTATTCTGAAAGTTGGACAA
CGTTGTAATGGTCATACTGTTGTTTTCATTTGGTCTGCCT
ATTATTTAATGTTTGGAGGACGTAGATTTTTAACTGCAAC
ATCAAGGGATGAATTTCATAAGTCTGTATTTTGTATATCT
AAGCCTGATGTACACTAATCCTTAATAATTTTTTTTTTCT
TCCCA

srp9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA srp9-201 (1)    Ensembl 596
srp9-202 725
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srp9-202 Contained in:
[BAC] DKEY-5G7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049066 (1),  Ensembl_Trans:ENSDART00000149171 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049522 (1) 757 nt
CITATIONS (2)