ZFIN ID: ZDB-TSCRIPT-110325-370
Transcript Name: ihhb-202
Previous Name: ihhb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048978 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048978|OTTDARG00000034594|ZDB-GENE-980526-135 ihhb|OTTDARP00000038433 ihhb-002 LG_ CU655960.18 Danio rerio protein_coding KNOWN, 979 bp
ACCACCTGAACCAGTCTTGAGGAAAACCCCATAGGACCAA
GCAATGAACGAAGGGTGGAAAGGCCAGAGAGCATTCAATA
GCAGCAAAAACAGGCGGCTGTTTTCCTGGAAGGGCTCTGG
TGACCATGAAGGATGGTTCCCATCGACAAATCCGTGATTT
GCGGGCAGGAGACTTGGTTCTGGCCTCTGAGGGAAGCGAC
GGGACAGGAGACCTCATCTATAGTGAAGTCCTCACCTTTT
TGGACCGTCGCCCCATTACCCAGAAGCACTTCTATGTGAT
CCGCACTGAGGATGGGGCCAGCGTGTCTTTAACAGCGGCT
CATTTACTGTTTATCAGGGTTGGAAACTGCTCCAACAGGG
GGGAACCCAAACCAGGAGCAGTCCGGACGATATTTGCCAG
CGATGCTCAAGTGGGTCAGTGTTTGCTGCTGGGTAAACTC
AGGAAGCGTTTTTCACAGATCACTCATGTTGGGGTTCGGG
AGGACCAGGGGTTATACGCTCCACTTACTGCTCATGGGAC
TGTAGTGGTGAACGATGTGCTCACCTCTTGTTATGCTGCG
GTGAACAGGCAAAGACTTGCTCATTGGGCTTTTGCACCTC
TACGCTTGCTGTATAGCTGGACCGGACCAGATCAGGTCCT
TAAGAATGGCTTACACTGGTACTCTCAGGTCCTGATAGGT
TTGGGAAAACTACTGCTAGAATCAGAACTCTTCCACCCTT
TGGCCTTAGAGGCAACAGAGAGATGATGGATTGAAATGAA
ACGCAGGGATTGGTGGAGATAGTTGTCAAAAGACATGATC
ACAAGCTCAGGGTTTGTGATGTAAAAGGTCACCTTGATGT
CAAAACGACATCAAAAACACATTAAAAATGTCAAAAATGG
AAATTAATTTGATGTCAGTTGAACAGTGTTGCCAACTTAG
TGACTTTGTCGCTATATTTAGCGATAATTTTAGACCCCCC
TAGCGGCAAATTAAAAAAA

ihhb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ihhb-201 (1) 1717
ihhb-202 979
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ihhb-202 Contained in:
OTHER ihhb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048978 (1)
  • Ensembl_Trans:ENSDART00000122719 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090433 (1) 1005bp
    GenBank:CK676670 (1) 748bp
    CITATIONS (2)