header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-358
Transcript Name: lmo4b-201
Previous Name: lmo4b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048933 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048933|OTTDARG00000034566|ZDB-GENE-030131-3570 lmo4b|OTTDARP00000038398 lmo4b-001 LG_ CU019652.27 Danio rerio protein_coding KNOWN, 1754 bp
CAGCGGCGAGACATCAGCGCGCGAGAGAGGACAGTTACAA
ACACAAGCGCTCTCTTCATCTATGGAAATTACCGAAGACC
TTGCCGACAGCTCCATCAACAAACCCGCCGCCGAGCTTTT
CAGTGATAATAAGAGCATCTGAGAAAAAAGGTGACGGCAA
CAGTGGAAATATAATCTGAAAACTCCATTTGCTTGACTCT
TTCGCAGCAGCGAGAAGTGTTCATCCACGCGCTGCTCCGT
CTGTGAGTTTGTTGGACTGTGCGCGTTATTTTTTATATAT
TTTCTACAGAGAAAACAGACTGCTGTACATTTCTCACCAC
CATTCAACCATTACATTTCAAAGAGACACAATGGTGAACC
CTGGAGGAAGTGCCCAGCCCCCACCTGTTGGAGCGGGATC
TCTGTCGTGGAAGCGCTGCGCGGGCTGTGGGGGAAAGATT
GCTGATCGGTTTCTCCTCTATGCCATGGACAGCTATTGGC
ACAGCCGCTGTCTGAAATGTTCCTGCTGCCAGGCCCAGCT
TGGAGAGATCGGCACATCCTGCTACACCAAGAGTGGCATG
ATCCTATGTAGAAACGACTACATCAGGTTATTTGGGAACA
GTGGGGCATGCAGTGCGTGTGGTCAGTCCATCCCAGCCAG
TGAACTGGTTATGAGGGCACAGGGAAACGTGTACCATCTC
AAGTGTTTCACATGTTCTACCTGCCGGAACCGGCTTGTCC
CTGGTGACAGGTTTCACTACATCAACGGCAGCTTGTTTTG
TGAACACGACAGACCCACAGCACTCATCAATGGCCATTTG
AGTTCATTGCAGACTAACCCTCTACTGCCTGACCAGAAAG
TGTGTTAGGACGTAGGTGTTGCTCCAAGCAGGATGTGTGC
CTTCATTTCAGCCCCTCGCTCATTGCCACCGAAGACTTTT
TTCGGATTGGCACCTCATCCCACTTCTTCTCAATGCTCCG
CTACTCCAAACCAGATCGCCAATCTCAGGCTTGAGCTCTA
CCGCAGACCTGCAACAGCCACCCTTTACCCCCCAAAACTC
CTGAATCATGGATGGAAAATACCCATGAGGCCCTGGAGGG
GGAAAACTGAGGACTCCATGAACTGACCCAAGAGAGACCT
CTGATCCCGAGTGACTCAAAGACGAAGGACAACGTTTTTT
GTTGGTAAAAACAGACTGAACGAGAAGCGTTTTTGCGAAA
TCTGCTTTCATAACACCTGTTTGAAAAGTGAAAAGGGGGA
ATACTGAACTTTTTTTGCTTTTTTTTATGTTTTCATAATT
TTTTTTTCCTACCTTGTCTATTCTCCTTTTCTTCACAACA
TGGTATCTTCTCTTTCTATATTTTAGATGTTGTAAAGGGA
ATGTGTTTCATTGCGGATGATATAAAAATCCAGAGGACTG
GATTCAAAGAAGTACCTGTGGCTTTTTTTGTGGAAAAAAA
ATCAAATCATGAACACTCTTGGTGTATTTGTAAAACTTAC
CATGTACAGTATGTATGCATGTAAATGTTTTTGTCCCATT
GTGGCTACCGTACATACTACACAGCAGCTAATCCTGTTTC
CTTTTCCCCCTCAAACCTGAAAATCACACAGACAAACAAA
CATAAAAAGTGATAATAATGAAGCTCATAGCTGTCAATCT
ATAAATGAGGAATGAGAGAGAATCTATTTGTGATATTTTC
CAGAGACATTTGCTCCAATATGGTGTATTTAATTAATAAA
AAATGAGATTAAAAACATCCCTTTTTTAATCCTA

lmo4b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA lmo4b-201 1754
lmo4b-202 (1) 880
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo4b-201 Contained in:
OTHER lmo4b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048933 (1)
  • Ensembl_Trans:ENSDART00000076997 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076053 (1) 1800bp
    GenBank:AF398515 (1) 1789bp
    GenBank:EH452574 (1) 977bp
    GenBank:CT726313 (1) 875bp
    GenBank:EB942372 (1) 692bp
    CITATIONS (2)