header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1266
Transcript Name: lmo4b-202
Previous Name: lmo4b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048934 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048934|OTTDARG00000034566|ZDB-GENE-030131-3570 lmo4b|OTTDARP00000038399 lmo4b-002 LG_ CU019652.27 Danio rerio protein_coding KNOWN, 880 bp
CATGTAGAGCACAAGCGACAAGCAGCGGCGAGACATCAGC
GCGCGAGAGAGGACAGTTACAAACACAAGCGCTCTCTTCA
TCTATGGAAATTACCGAAGACCTTGCCGACAGCTCCATCA
ACAAACCCGCCGCCGAGCTTTTCAGTGATAATAAGAGCAT
CTGAGAAAAAAGAGAAAACAGACTGCTGTACATTTCTCAC
CACCATTCAACCATTACATTTCAAAGAGACACAATGGTGA
ACCCTGGAGGAAGTGCCCAGCCCCCACCTGTTGGAGCGGG
ATCTCTGTCGTGGAAGCGCTGCGCGGGCTGTGGGGGAAAG
ATTGCTGATCGGTTTCTCCTCTATGCCATGGACAGCTATT
GGCACAGCCGCTGTCTGAAATGTTCCTGCTGCCAGGCCCA
GCTTGGAGAGATCGGCACATCCTGCTACACCAAGAGTGGC
ATGATCCTATGTAGAAACGACTACATCAGGTTATTTGGGA
ACAGTGGGGCATGCAGTGCGTGTGGTCAGTCCATCCCAGC
CAGTGAACTGGTTATGAGGGCACAGGGAAACGTGTACCAT
CTCAAGTGTTTCACATGTTCTACCTGCCGGAACCGGCTTG
TCCCTGGTGACAGGTTTCACTACATCAACGGCAGCTTGTT
TTGTGAACACGACAGACCCACAGCACTCATCAATGGCCAT
TTGAGTTCATTGCAGACTAACCCTCTACTGCCTGACCAGA
AAGTGTGTTAGGACGTAGGTGTTGCTCCAAGCAGGATGTG
TGCCTTCATTTCAGCCCCTCGCTCATTGCCACCGAAGACT
TTTTTCGGATTGGCACCTCATCCCACTTCTTCTCAATGCT
CCGCTACTCCAAACCAGATCGCCAATCTCAGGCTTGAGCT

lmo4b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA lmo4b-201 (1) 1754
lmo4b-202 880
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo4b-202 Contained in:
OTHER lmo4b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048934 (1)
  • Ensembl_Trans:ENSDART00000148748 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:GO937996 (1) 852bp
    GenBank:EH549729 (1) 423bp
    CITATIONS (2)