Transcript

ndufs1-201

ID
ZDB-TSCRIPT-110325-321
Name
ndufs1-201
Previous Names
  • ndufs1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048818 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048818|OTTDARG00000034500|ZDB-GENE-030131-478 ndufs1|OTTDARP00000038312 ndufs1-001 LG_none CT009620.9,CR847926.7 Danio rerio protein_coding KNOWN, 2515 bp
CGGCAGTAGCGCTGTTCTGGTCTAGAAGGCCAAATAGCGT
CAAGCGACATGTTGCGTTTGCCAGCTGTAAGTCGGGCTTT
GGCAGCTCATTCCAAGGGCTCCATTGCCACAACCAACAAT
GTACGGACCTCCGTCCGGGCTGCGAGCAATATGGTTGAAG
TGTTTGTAGATGGTAAACCTGTCATGGTGGAGCCAGGAAC
CACTGTACTACAGGCTTGTGAGAAAGTTGGTGTGCAGATT
CCTCGTTTCTGCTATCATGATCGTCTGTCAGTGGCCGGTA
ACTGCCGTATGTGTCTGGTTGAGATCGAAAGAGCGCCAAA
GCCTGTTGCTGCATGTGCAATGCCAGTCATGAAAGGATGG
AACATTTTGACCAACTCAGAGAAAACGCGTAAAGCCAGAG
AGGGAGTCATGGAGTTCTTGCTTGCCAACCACCCTCTTGA
CTGTCCAATCTGTGATCAGGGAGGAGAGTGTGATCTGCAG
GACCAGTCGATGATGTTCGGCACAGACAGAAGCCGCTTTA
CTGAAGGCAAGAGGGCAGTGGAAGACAAGAACATCGGGCC
GCTCATCAAAACAATCATGACTCGCTGTATACAGTGCACC
CGTTGTGTTCGTTTTGCCAGTGAAGTTGCTGGAGTGGAGG
ATCTGGGAACCACAGGACGTGGTAACGACATGCAGATTGG
TACCTACGTGGAGAAGATGTTCATGTCTGAGTTGTCTGGA
AACATAATCGACTTGTGTCCTGTTGGAGCACTGACATCTA
AACCATATGCCTTCACTGCAAGACCCTGGGAGACCAGAAA
GACCGAGTCTATCGACGTGCTGGATGCTGTTGGCTCCAAC
ATTGTGGTGAGCACCAGAAGTGGTGAAGTCATGAGAATTC
TGCCCCGCATGAATGAAGATGTCAATGAGGAATGGATATC
TGACAAGACCAGGTTTGCTTATGATGGGCTGAAGAGGCAG
CGTCTGACCCAGCCCATGGTAAGGGATGCTAGCGGGCAGC
TGGTTTCCACCACCTGGGAAGATGTCCTTACGCGTGTGGC
CGGAGCACTCCAGGGAGTTAAAGGTTCTGAGATTGGAGCT
ATTGCTGGTGGGATGGTGGACGCTGAGGCACTGGTGGCTC
TGAAGGACCTGCTGAACAAACTGGACAGCGAGTCTCTCTG
CACTGAAGAGATCTTCCCAATGGCTGGTGCTGGATCCGAC
CTGCGCTCCAATTACCTCTTGAACAGCCGTATCACTGGTA
TTGAGGAGTGTGACCTTCTGCTACTGATTGGGACAAACCC
TCGTTATGAGGCTCCTCTCTTCAATGCACGTATCCGCAAG
AGTTGGTTGCATAATGAGCTCCAAGTGGCCATGGTGGGTC
ATGATGTGGATCTGAGCTACTCTTACAACCATCTGGGTGA
AACCACACAGGTTCTGCAGGACATTGCTGCTGGAACACAT
CCTTTCTGCAAGGACCTCGGCCAAGCCAAAAAGCCTATCG
TGGTGGTGGGTAGCTCTGCTCTTCAGAGGGATGATGGGGC
AGCCATCTTAAAGGCTGTGTCCACAATTGCTCAAAATGCT
CGGGCCAGCAGTGGTGTTGAGGAGGGATGGAAGGTTCTCA
ATGTACTGCACAGGGTGGCCAGTCAAGTGGCAGCTCTGGA
CTTGGGTTATAAACCTGGTGTTGATGCCATTCGGAAGAAT
CCTCCCAAAGTGCTGTTTCTCCTGGGAGCTGATGCCGGAT
GCATCACCAGAGCAGACCTTCCTAAAGATAGCTTTATCGT
TTACCAGGGTCACCATGGTGATGTAGGTGCACCTATTGCT
GATGTCATCTTGCCTGGTGCTGCGTACACTGAAAAGTTTG
GCACCTACGTCAACACAGAGGGCCGTGCACAGCAGACCAG
GGTGGCAGTCACCGCTCCGGGTATGGCACGTGAGGACTGG
AAGATATTGCGTGCCGTTTCTGAGTTGGTAGGAGTCACGC
TGCCGTATGACACACTGGATGAGGTAAGGAGAAGGCTGGC
TGAGGTTTCTCCTAACCTGGTGAGATACGATGATGTAGAG
GAAGCCAATTATTTCAAACAGGCCCATGAGCTTTCAAATG
CTGTGAATCAGTCATTGCTTGCAGCTCCTCTTGTCCCTCC
TCAGCTCACAGTAAAGGATTTCTACATGACAGACCCCATC
AGCAGAGCTTCTCCGACAATGGCCAAGTGTGTGAAAGCTG
TGACGGAGGGAGCAGCAGCGGTTGATGAGCCCTCAATTTG
TTAAAAACCTTTCAGGCATACCGATCTGTCCGTAGTACTA
CGCACAAAAGTAGTCTTCGTCACGTACATGAACGAACACA
AACCTCTGTTTCTGCTTACTCAGCTCTCTGTGTTCTTGCA
CGGGCTGCACAAGAGCCTAATTAAAACGTGCTCATATTTA
AATAGGCTTTGAACGGTGTTGTAAAGTTTTCATTCCCACG
ATGAATCTGAATGAGGTCTGCTTTGTTTTGGAAAGCTCTT
ATTATGATGAATAAAAATAAAATGTATTATATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations