header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-271
Transcript Name: irx4a-201
Previous Name: irx4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048488 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048488|OTTDARG00000034288|ZDB-GENE-040426-1825 irx4a|OTTDARP00000038031 irx4a-001 LG_ CU468021.7 Danio rerio protein_coding KNOWN, 2067 bp
CAAAATATGTATTTCTGACATCAAAGGCGACAACACTCGC
AGTTTCTTTCAGGATGTGCGCGTTGTAGAAGTTTATCAGT
GCGACAGGAGGGATAAATCAAAGCGTGCATCAGTTGAACA
TCTCCTGGAAGGCGTTTAAAGCGAATTAAACATGCTAGAA
TCGCGCTTCGCCCTATAAGCGTCCGGCAGCTTTATGCGTT
ACCAATCAATCGGTACACTGAAACACAGCAGACCTGCAGT
CTCGCCTGCGTTCCGCGAAAGGGGGATCACTTTACAATGT
CCTATCCTCAATTCGGATACCCATACTCTTCTGCACCTCA
GTTCCTCATGACCACCAACTCTCTGACATCTTGCTGCGAG
TCGAGCACCAGATCCATCCCGGACTCATCGGCGCAGACCC
CCGTGTACTGCCCGGTGTACGAGAGCCGGCTGTTGGCCAC
CGCCAGACACGAGCTCAGCTCCGCCGCCGCGCTCGGGGTC
TACGGCAGCCCGTACACCGGCGGACAAGGCTACGGGAATT
ACGTGACCTACGGAGCTGACGCATCGGCGTTCTACTCTTT
GGGAACATTTGACGCCAAAGATGGAAGCGCGTCTGCGCAT
GCGGGGATAACACCGGCTGCCGCATATTACCCATACGATC
CCACCCTGGGACAGTACCAGTATGACAGGTACGGCTCTAT
GGAGGGCGGGACCCGCAGGAAAAACGCCACCCGGGAGACC
ACGAGCACGCTGAAGGCCTGGCTGCAGGAGCACCGGAAAA
ACCCCTACCCGACCAAAGGAGAGAAGATCATGCTGGCCAT
CATCACCAAGATGACCCTCACTCAGGTGTCCACCTGGTTC
GCCAACGCCAGAAGGAGACTCAAGAAGGAGAACAAGATGA
CCTGGCCACCGAGGAACAAGGGCTCGGACGAGAAGAAGTA
TGATGATGATGAGGATGGATCACCAGAGGAGCAGATCAAG
AGTGAAACCAATGATGACGAGAGCAAAGATCGAGAGGACA
AGGATCTGCAGCTGAGCGACCTGGAGGACTTCGACCCACT
GGAGTCTGAGAGCCCGGAGTGTGAACTCAAGCACCGCTTC
CAGATCAGCGCGCACATGGAGACCAAAGACCCGCAGAAAC
TTTCCATCCCCGGGCTGCTGGAGGAGGCCAAGAGCTGCCT
GAAGAGCCCGGAGGACTGCGAGCTGGAGCTCCGGCACAGC
AAAGCGTGTTTCCAGCAGCAGCAGCAGCAGAGCCACCCGA
TACTAGACAGCAAACCGCGGATCTGGTCTCTGGCGCAGAC
CGCCACCTCCCTGAACCCCGCGGAGTTCCCGTCCTGCATG
CTCCGGTGCCCGGCCTCGCCCTCCCCCGCCGGCGGCCCCG
ACAGACAGCAGGACTCACCGGTCACCACGCTCAGAAACTG
GGTAGACGGAGTTTTTCACGACCCCTTGTTCAGACACAGC
TCGTTAAACCAGACGAACACTACTGTTTCTTGGACCAACA
AAGGCTCGATTCTAGAGACAGGAGCCCTGGGACGCTCGGT
GGCGGACAGCGGCAAGCAGGAGGCCGGCAAGGACACTATG
ACATTTCCAAAGGGGGTGAATAAAATATTCTGCTCCTAGC
ACACTGGACATGACTGCCAGAAAGAGACTGTTTGGAATAG
CTGTCTGCGGTTTTCTGTGCGCAGACTGTGAATCCACATG
GGCCCAAAACTGGTTTTGTTATCGCGGGAAGTTGTGTGTA
TTTATTGCTGTATGACATCTCACTGGCGACGGCATTGGTT
TATATATATATTGGTTTGGTTGACGCACGTTCAGATTATG
TAAATGAACTGGAAGTTTATGTTCTGAAAGACTGACAAAA
GTTTACAGCCCAGTTTGGTTTCAGCTTTTCTTTGGCATGC
ATATGTTGCTAGATTTTCTATTTGATTTTATTATTATTAT
CGGTCATTCTTTTAGACGGACTCGGACCTTGTTGCATCGA
CTCACAAGTGTCACTATTAAGAAAGTATCGCACACATGCA
CAGATCTCCTGGAATGGAGAATGTTCAACCTGATCACTCT
AATAAACGGTCGATTTTTCCAAGCGTT

irx4a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA irx4a-002 (1) 938
mRNA irx4a-201 2067
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
irx4a-201 Contained in:
[Fosmid] CH1073-217P23 (1) (order this)

OTHER irx4a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048488 (1)
  • Ensembl_Trans:ENSDART00000051693 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065966 (1) 2101 bp
    GenBank:AY845128 (1) 2088 bp
    GenBank:CA476724 (1) 958 bp
    CITATIONS (2)