header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1179
Transcript Name: irx4a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048489 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048489|OTTDARG00000034288|ZDB-GENE-040426-1825 irx4a|no_translation irx4a-002 LG_ CU468021.7 Danio rerio protein_coding KNOWN, 938 bp
TCTGCGCGGTAATTCGGGGCTTCCCTCTGCGCTTATCAGT
TTACAAATCTACGAGCACCGACACAGAGGCGACGGCTGGG
GGAAGGAGGACAACAGTTGTTTTGTTGGCCACGATCCATG
TAGTGTCCTGCGGGGGCGGACTGTGCCAAAAATCAACTTT
CACTGCGTGTTTTGGAGCTTTTTAAAGTCGGGTTTCTGTG
TGTGTTCATGCTGTGATTTCTCCTGATTGTTCCAGTTCCT
CATGACCACCAACTCTCTGACATCTTGCTGCGAGTCGAGC
ACCAGATCCATCCCGGACTCATCGGCGCAGACCCCCGTGT
ACTGCCCGGTGTACGAGAGCCGGCTGTTGGCCACCGCCAG
ACACGAGCTCAGCTCCGCCGCCGCGCTCGGGGTCTACGGC
AGCCCGTACACCGGCGGACAAGGCTACGGGAATTACGTGA
CCTACGGAGCTGACGCATCGGCGTTCTACTCTTTGGGAAC
ATTTGACGCCAAAGATGGAAGCGCGTCTGCGCATGCGGGG
ATAACACCGGCTGCCGCATATTACCCATACGATCCCACCC
TGGGACAGTACCAGTATGACAGGTACGGCTCTATGGAGGG
CGGGACCCGCAGGAAAAACGCCACCCGGGAGACCACGAGC
ACGCTGAAGGCCTGGCTGCAGGAGCACCGGAAAAACCCCT
ACCCGACCAAAGGAGAGAAGATCATGCTGGCCATCATCAC
CAAGATGACCCTCACTCAGGTGTCCACCTGGTTCGCCAAC
GCCAGAAGGAGACTCAAGAAGGAGAACAAGATGACCTGGC
CACCGAGGAACAAGGGCTCGGACGAGAAGAAGTATGATGA
TGATGAGGATGGATCACCAGAGGAGCAGATCAAGAGTGAA
ACCAATGATGACGAGAGCAAAGATCGAGAGGACAAGGATC
TGCAGCTGAGCGACCTGG

irx4a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA irx4a-002 938
mRNA irx4a-201 (1) 2067
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
irx4a-002 Contained in:
[Fosmid] CH1073-217P23 (1) (order this)

OTHER irx4a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048489 (1)
  • Ensembl_Trans:ENSDART00000148951 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH998272 (1) 966 bp
    GenBank:FP114174 (1) 697 bp
    GenBank:FP130841 (1) 529 bp
    CITATIONS (2)