Transcript

otx5-201

ID
ZDB-TSCRIPT-110325-2708
Name
otx5-201
Previous Names
  • otx5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051122 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051122|OTTDARG00000035873|ZDB-GENE-030508-1 otx5|OTTDARP00000040183 otx5-001 LG_ CU633848.8 Danio rerio protein_coding KNOWN, 1747 bp
ATTCATCTCACTGTCACCGGGAGACCGAGACACGCGCACC
GAGCGCTCAGCCGCAGCACCGGACACACTAACAGACCGCT
GATGAGCTCACACACACACACGATCAACACATACACACAC
TCGAGCTCGTCTACACGCTGCTGACTGATAGAAAAAGTCC
ATCAGAGACAGAAACACACAGAAAGAGAGAGAGAGGAGGA
GAGAGAAAGAGAGAGAGAGAGAGTTTAGTCATGATGTCCT
ACATGAAACAGCCTCATTACTCCGTTAACGGGTTGACTCT
GTCCGGTACCGGGATGGATCTCCTGCACTCCGCCGTCGGT
TACCCTAACACTCCACGGAAACAGCGGCGCGAAAGAACCA
CCTTCACGCGTGCGCAGTTGGACGTGCTGGAGGCGCTGTT
CTCCAAAACCCGATACCCGGACATATTCATGAGGGAAGAA
GTGGCTCTCAAGATCAACCTGCCCGAGTCTAGAGTCCAGG
TCTGGTTTAAGAACCGTCGTGCCAAATGCCGTCAGCAGCA
GCAGCAGCAGACCAGCGGTCAGACCAAACCCAGACCACCC
AAGAAGAAGTCTTCTCCGGCTCGTGACTCCAGTGCCAGTG
AGCCCAGCGCCAGCACCAGTGGCCCCTACAGCCCCCCACC
ACCCCCGCCTGGCACCGCCATCACCCCCAGCTCCAGCAGC
GCCACCGTATCTATCTGGAGCCCGGCCTCCATTTCTCCAC
TGCCCGACCCGCTGTCCGCCCCCAGCACCGCCTGCCTGCA
GCGCTCCAGCTATCCTATGACCTACAGCCAAGCGCCGGCC
TATGGGCAGAGCTACGCCGCCTCCTCATCCTACTTTACAG
GCCTGGACTGCAGCTCGTACCTGTCCCCAATGCACCCGCA
GCTATCAGCCAGCGGGGGCGCTCTCAGCCCAATGAGCGGA
GCCCTCAGCCAATCGCCGGCCTCGCTTTCATCTCAGGGTT
ACACCGCCGCATCACTGGGCTTCGGCGCCGTCGACTGCTT
AGATTATAAAGACCAGACGTCAGCCTGGAAACTGAACTTC
AACGCCCCAGACTGTCTGGACTACAAGGACCAGAATTCCT
GGAAGTTCCAGGTGCTGTAGGCGGAGCTTCAGATAAAAAA
GGCGGAGTTTAAGAAACGCATTCGTTTAGAAACTACAGAA
CTTTCTGTGCAGTTAAAGAGTGGGGGTCTCATTTATAAAC
CTTGCATAGAAACCTTATTAATAGTGAACGTACAGCTGAA
TATGTTTAATTTATTTTTAATTATTATGACTTTATGGTCA
TATATGATGATTAAAGTTGTTAAGTCAACATTTAAAGTTA
AAATAGTTTCCTTGGAGTCTACTCACAGCTGCGCACATGC
TCCTGTTCAGTTTGTTTTTAATAAAATCAAACTTTTGCCT
GTTAAGTGGAGTACGCTTATTTGCACCTCTGGTTTTATTT
TGCATACGCCATGTTTATAAATAAGACCCCAGGTCATGTG
GTATTCTAAAAGAAAACACTGAGCTTCTAGAAATTTGCTC
ATGACTGTTTTTCAAACGATTTGAGGCTTAATCAGATTAT
AAAGACCAGACCTCAGCCTGGAAACTGAGCAAAAAGGGCA
TGAAATCACCAAGAGGCGACACTCTAGTGCAGTTTGGGAA
ACAGCCACTAGATGGCGCGGCGGCTATTTTTGGAATGAAA
ACTCCAATAGAACGACAGCATATTATAAGTCTGTAAAATA
AACGATTAAAAGTGCTGATGATTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations