Transcript

map1lc3b-201

ID
ZDB-TSCRIPT-110325-2635
Name
map1lc3b-201
Previous Names
  • map1lc3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000050821 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050821|OTTDARG00000035682|ZDB-GENE-030131-1145 map1lc3b|OTTDARP00000039905 map1lc3b-001 LG_ CU571064.7 Danio rerio protein_coding KNOWN, 1816 bp
ATATGCGCCGTGACGTCACAGATCAGCTGACTAGTTTGTT
TTGTAAAGACGGACTTCACAGGACGAAGCAACGACGCGCA
ACTGAAATACACGGTTTCGCATTATATATAAAACATAAAG
ATCTAAAAACCTGTTCAGAAACAAAAAACGATAGAAATTA
GGCAGATCTGCCTAAAACAAACGTGTTTAATCACATTTAA
AACATGCCTTCGGAAAAGACATTTAAACAAAGGAGGACAT
TTGAGCAGCGGGTGGAGGATGTACGGCTGATCCGGGAACA
GCATCCAAACAAGATCCCGGTCATCATCGAGAGATACAAG
GGAGAGAAGCAACTGCCGATTCTTGACAAAACTAAGTTTC
TAGTTCCTGACCACGTTAACATGAGCGAACTTATTAAGAT
TATCAGGCGACGCCTCCAACTCAACTCCAACCAGGCTTTC
TTCCTGCTGGTCAACGGTCACAGCATGGTATCTGTGTCCA
CTGCCATTTCTGAGGTCTATGAACGGGAAAGAGACGAAGA
CGGCTTTCTGTACATGGTCTACGCTTCCCAGGAGACATTT
GGATTTCAGTAAAAAAAACAAATGTATGGCAAAACGATTG
GCTTTCACTCATGGACAATGATACAACCTAGCCTGAACTC
TTCTGACCTTTCCCCCACATATAACCCTATCACGTTTCCC
TTCCCCATCCAATCAGGAAGCAGCTGAACTTTCATTCATT
TGGCTCCAAAACCATTATCCATTATCCAAAGCTAAAACCT
AACACCTTACATCTCAAGCTCGAGTCCCTTCTGTTACTTT
GGTGTCTTCAAAATGGATAAGTTGAAGGTCGTAGGACAGG
TTATGGTTTACTTGGGCTACCCAAACACAAAGCTTGAACA
AAAAAAGACTTCTGAGATGAAATAGTCTCACTTTCTTAGC
GGTTGAATTCCAGAAATTGCATCTAGTGTAATGTTAGGCG
GCCAAAACAGTTTTTGAGGTTATCCATCAGGTCCTGGTGA
CTTTTAACCCTATTGTGTCATTTCTCAAACTTTTTAATTG
TCAGCCTTTTCTTACCTGTAGATGTCAAACCGAGTTTTCC
GCTGCTCCATTTTCCTGTTAGAAGCAGTCTTTTCATTTCC
CCCTTGAGCTTTTTTTGCTAACTGTGTCACGAGCGTTGAG
GTTCTTGGATTTCACAACACAAGGTTCGAAGTGACGTCCT
ACTTGCCTTGTTGACATTTTGATCCGGTGGGACTTGCCTG
AGGAAGTAAGATAGTATGCAAATTAAAATACGAGAAATTC
TGCTTTGATTGTAGTGCGAAGCTTTAAGAGTCCAAGTTTA
GGAAAACGTCATTATAATGGTACATTGAGCGAACGAATGT
GACGATTGGACACGAGTGCTGCCCGAACATCCTTGCTCTT
TTAGGTGCACGCTTTTAGACTTTTCAATTTTATTAGAGGA
TTATTTACTACACCTTTATAAACGCATAACCGTGAGCTGT
TGTACTCTTTCCATCTGTATGTCTTACAGTAAACTGTACA
GATAAGCTTAGATGCCTTTTCTCCTAAGCATTTACTTGCT
GTTTGTCTTGCTCTTATTTAAAGACATTTTTTTTTCATTG
TTTTGTTCATGTAAAAAACGAGAAAAATTCACATGTGCTA
CTATTGTGCAATTTACAAGTTTATTTGAATGAGAGTTTAA
CTTTAAAGGATTATAATATCAACCCATTTATCGAACTAAA
GCTCATTTTCTTCTGTGCTCCTCCTGCTCAGATTTACAGC
AATATCACACTTCTATTTCTGTTGATATTTTAAAAATAAA
TGAGGAATATGCAGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations