ZFIN ID: ZDB-TSCRIPT-110325-2500
Transcript Name: grsf1-201
Previous Name: grsf1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050181 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050181|OTTDARG00000035282|ZDB-GENE-060825-196 grsf1|OTTDARP00000039387 grsf1-002 LG_ BX323596.9 Danio rerio protein_coding KNOWN, 885 bp
CGGGATTTGCGCTCCAAATAAGCTGTACCATGCCGTGTTT
ATGCCGTGTATATGTTTAGGGTTTCACGTAGGTTTAAGTT
TAATTTTGCACAATTTAAGATGTCTGGACTGAGTCGAAGC
GCGCTCTTGTTCTCTCTTGTTCGCTGTGTCAGGAGATCGC
CGCGGTTTCCATGCCTAGAGACTCTGAATCATAGTAAAAC
TGCGCAGTTAACTTCAGCACGAGGTCTGAGTGTTCATTCA
TTGACAACAAGATATTTAGCAGACTGTAAAGCCAAGAATC
CATGGATGTTTTCTCAACGAAGTCTGTGCTCTGAGGCACC
ATCTAAAGATGATGAGTACCCTCCTCTACCAGAATACACC
CCTGGTTCTGAAGAGAACCAAGCAAAGGAGTTGTTCATCG
TCCAGGCTAAGGGTCTGCCCTGGTCCTGTACAGCTGAAGA
CATAATGAGCTTCTTTTCTGAGGAAAGAAAACTATTTGGA
ACAAGTTAGAGAATGTAGGATCCGAGGAGGAGTCAATGGA
GTCCATATTCTGTATAACAAGTACGGCAAGCCATCAGGAC
AAGCGTTCATCGAGCTGGAGCACGAGGAGGATGTTGGCAA
AGCACTGGATCAACACCGCCATTACCTAAGAGATCGCTTT
ATTGAAGTCCGTGAAGTAACAAACAAAGATGCTGAAGCCA
TATTAAAAGCTTCAAAGGAGCGTGTGGAGACAGATACAGT
GGTACGACTACGAGGGCTTCCCTACAGCTGCACGGAGGGA
GACATCATTAGATTTTTCTCAGGGTTGGATGTTGTGGAGG
ACGGAGTTACTATAATTCTCAACCGCAGAGGGAAAAGCTC
AGGCGATGCCTTCGTAGAGTTTGCTACAAAGGCAATGGCT
GAAAA

grsf1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript grsf1-201 885
mRNA grsf1-202 (1)    Ensembl 1451
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grsf1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000050181 (1),  Ensembl_Trans:ENSDART00000149549 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CA787644 (1) 890 bp
CITATIONS (2)