Transcript

grsf1-201

ID
ZDB-TSCRIPT-110325-2500
Name
grsf1-201
Previous Names
  • grsf1-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050181 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050181|OTTDARG00000035282|ZDB-GENE-060825-196 grsf1|OTTDARP00000039387 grsf1-002 LG_ BX323596.9 Danio rerio protein_coding KNOWN, 885 bp
CGGGATTTGCGCTCCAAATAAGCTGTACCATGCCGTGTTT
ATGCCGTGTATATGTTTAGGGTTTCACGTAGGTTTAAGTT
TAATTTTGCACAATTTAAGATGTCTGGACTGAGTCGAAGC
GCGCTCTTGTTCTCTCTTGTTCGCTGTGTCAGGAGATCGC
CGCGGTTTCCATGCCTAGAGACTCTGAATCATAGTAAAAC
TGCGCAGTTAACTTCAGCACGAGGTCTGAGTGTTCATTCA
TTGACAACAAGATATTTAGCAGACTGTAAAGCCAAGAATC
CATGGATGTTTTCTCAACGAAGTCTGTGCTCTGAGGCACC
ATCTAAAGATGATGAGTACCCTCCTCTACCAGAATACACC
CCTGGTTCTGAAGAGAACCAAGCAAAGGAGTTGTTCATCG
TCCAGGCTAAGGGTCTGCCCTGGTCCTGTACAGCTGAAGA
CATAATGAGCTTCTTTTCTGAGGAAAGAAAACTATTTGGA
ACAAGTTAGAGAATGTAGGATCCGAGGAGGAGTCAATGGA
GTCCATATTCTGTATAACAAGTACGGCAAGCCATCAGGAC
AAGCGTTCATCGAGCTGGAGCACGAGGAGGATGTTGGCAA
AGCACTGGATCAACACCGCCATTACCTAAGAGATCGCTTT
ATTGAAGTCCGTGAAGTAACAAACAAAGATGCTGAAGCCA
TATTAAAAGCTTCAAAGGAGCGTGTGGAGACAGATACAGT
GGTACGACTACGAGGGCTTCCCTACAGCTGCACGGAGGGA
GACATCATTAGATTTTTCTCAGGGTTGGATGTTGTGGAGG
ACGGAGTTACTATAATTCTCAACCGCAGAGGGAAAAGCTC
AGGCGATGCCTTCGTAGAGTTTGCTACAAAGGCAATGGCT
GAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations