header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1592
Transcript Name: grsf1-202
Previous Name: grsf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050180|OTTDARG00000035282|ZDB-GENE-060825-196 grsf1|OTTDARP00000039386 grsf1-001 LG_ BX323596.9 Danio rerio protein_coding KNOWN, 1451 bp
TGAACTACTATTTTGAAAGATCTTGTCAAACTCCGAGGCG
CCTTTTGATGACGTCATGTTGTCCTCTGATGCCGTAGGTC
AACGGGATTTGCGCTCCAAATAAGCTGTACCATGCCGTGT
TTATGCCGTGTATATGTTTAGGGTTTCACGTAGGTTTAAG
TTTAATTTTGCACAATTTAAGATGTCTGGACTGAGTCGAA
GCGCGCTCTTGTTCTCTCTTGTTCGCTGTGTCAGGAGATC
GCCGCGGTTTCCATGCCTAGAGACTCTGAATCATAGTAAA
ACTGCGCAGTTAACTTCAGCACGAGGTCTGAGTGTTCATT
CATTGACAACAAGATATTTAGCAGACTGTAAAGCCAAGAA
TCCATGGATGTTTTCTCAACGAAGTCTGTGCTCTGAGGCA
CCATCTAAAGATGATGAGTACCCTCCTCTACCAGAATACA
CCCCTGGTTCTGAAGAGAACCAAGCAAAGGAGTTGTTCAT
CGTCCAGGCTAAGGGTCTGCCCTGGTCCTGTACAGCTGAA
GACATAATGAGCTTCTTTTCTGAATGTAGGATCCGAGGAG
GAGTCAATGGAGTCCATATTCTGTATAACAAGTACGGCAA
GCCATCAGGACAAGCGTTCATCGAGCTGGAGCACGAGGAG
GATGTTGGCAAAGCACTGGATCAACACCGCCATTACCTAA
GAGATCGCTTTATTGAAGTCCGTGAAGTAACAAACAAAGA
TGCTGAAGCCATATTAAAAGCTTCAAAGGAGCGTGTGGAG
ACAGATACAGTGGTACGACTACGAGGGCTTCCCTACAGCT
GCACGGAGGGAGACATCATTAGATTTTTCTCAGGGTTGGA
TGTTGTGGAGGACGGAGTTACTATAATTCTCAACCGCAGA
GGGAAAAGCTCAGGCGATGCCTTCGTAGAGTTTGCTACAA
AGGCAATGGCTGAAAAGGCCCTGAAGAAAGACAGAGAAAT
CTTGGGAAATAGGTATATTGAGATCTTCCCAGCCATGAAA
AGTGCCATCCCGTCCCAAAATAGAAGCTGGCAAAATGACA
GAGTTTTCACACCAAGAGCTGAGGACCCTCCACTCAGAAA
TACAACAGTTACAAAGAATGTCATTCACATGAGAGGTCTG
CCGTTTGATGCAAAAGCAGAGGACATTGTAAAGTTTTTCG
CTCCTGTCCGACTTATGAAGGTTGTTGTAGAGTTTGGTCC
TGAAGGAAAACCCACCGGTGAAGCAGAGGCTTATTTCAAA
ACACATGAAGACGCCGTTTTAGCCATGTCCAAAGACAGAG
AGTTCATAATGGAGCGATATATTGAGTTGTACCTGAATTC
ATGTCCACCCAGCGAAGAACGATAAGATGAAAGGACACCA
TATTTAAATGCACTGCATCCCAATCTGCTACAAATTAACC
CAGTGTATCATGTACATTGCAAGAACCAACATTAAAAGCG
GACTCTACAAA

grsf1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript grsf1-201 (1)    Ensembl 885
mRNA grsf1-202 1451
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grsf1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000050180 (1),  Ensembl_Trans:ENSDART00000149868 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC122226 (1) 1306 bp
GenBank:BC164250 (1) 973 bp
GenBank:CV105780 (1) 804 bp
GenBank:CT635142 (1) 677 bp
GenBank:AI497414 (1) 592 bp
CITATIONS (2)