Transcript

grsf1-202

ID
ZDB-TSCRIPT-110325-1592
Name
grsf1-202
Previous Names
  • grsf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050180 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050180|OTTDARG00000035282|ZDB-GENE-060825-196 grsf1|OTTDARP00000039386 grsf1-001 LG_ BX323596.9 Danio rerio protein_coding KNOWN, 1451 bp
TGAACTACTATTTTGAAAGATCTTGTCAAACTCCGAGGCG
CCTTTTGATGACGTCATGTTGTCCTCTGATGCCGTAGGTC
AACGGGATTTGCGCTCCAAATAAGCTGTACCATGCCGTGT
TTATGCCGTGTATATGTTTAGGGTTTCACGTAGGTTTAAG
TTTAATTTTGCACAATTTAAGATGTCTGGACTGAGTCGAA
GCGCGCTCTTGTTCTCTCTTGTTCGCTGTGTCAGGAGATC
GCCGCGGTTTCCATGCCTAGAGACTCTGAATCATAGTAAA
ACTGCGCAGTTAACTTCAGCACGAGGTCTGAGTGTTCATT
CATTGACAACAAGATATTTAGCAGACTGTAAAGCCAAGAA
TCCATGGATGTTTTCTCAACGAAGTCTGTGCTCTGAGGCA
CCATCTAAAGATGATGAGTACCCTCCTCTACCAGAATACA
CCCCTGGTTCTGAAGAGAACCAAGCAAAGGAGTTGTTCAT
CGTCCAGGCTAAGGGTCTGCCCTGGTCCTGTACAGCTGAA
GACATAATGAGCTTCTTTTCTGAATGTAGGATCCGAGGAG
GAGTCAATGGAGTCCATATTCTGTATAACAAGTACGGCAA
GCCATCAGGACAAGCGTTCATCGAGCTGGAGCACGAGGAG
GATGTTGGCAAAGCACTGGATCAACACCGCCATTACCTAA
GAGATCGCTTTATTGAAGTCCGTGAAGTAACAAACAAAGA
TGCTGAAGCCATATTAAAAGCTTCAAAGGAGCGTGTGGAG
ACAGATACAGTGGTACGACTACGAGGGCTTCCCTACAGCT
GCACGGAGGGAGACATCATTAGATTTTTCTCAGGGTTGGA
TGTTGTGGAGGACGGAGTTACTATAATTCTCAACCGCAGA
GGGAAAAGCTCAGGCGATGCCTTCGTAGAGTTTGCTACAA
AGGCAATGGCTGAAAAGGCCCTGAAGAAAGACAGAGAAAT
CTTGGGAAATAGGTATATTGAGATCTTCCCAGCCATGAAA
AGTGCCATCCCGTCCCAAAATAGAAGCTGGCAAAATGACA
GAGTTTTCACACCAAGAGCTGAGGACCCTCCACTCAGAAA
TACAACAGTTACAAAGAATGTCATTCACATGAGAGGTCTG
CCGTTTGATGCAAAAGCAGAGGACATTGTAAAGTTTTTCG
CTCCTGTCCGACTTATGAAGGTTGTTGTAGAGTTTGGTCC
TGAAGGAAAACCCACCGGTGAAGCAGAGGCTTATTTCAAA
ACACATGAAGACGCCGTTTTAGCCATGTCCAAAGACAGAG
AGTTCATAATGGAGCGATATATTGAGTTGTACCTGAATTC
ATGTCCACCCAGCGAAGAACGATAAGATGAAAGGACACCA
TATTTAAATGCACTGCATCCCAATCTGCTACAAATTAACC
CAGTGTATCATGTACATTGCAAGAACCAACATTAAAAGCG
GACTCTACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations