Transcript

cyp26c1-201

ID
ZDB-TSCRIPT-110325-2433
Name
cyp26c1-201
Previous Names
  • cyp26c1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049864 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049864|OTTDARG00000035081|ZDB-GENE-050714-2 cyp26c1|OTTDARP00000039123 cyp26c1-001 LG_ CU571091.4 Danio rerio protein_coding KNOWN, 4032 bp
AGACTCATATAGCTCACCTAACAGAGACAGAATCTGAAAG
GGGATATTTTTACAGTCGTGCTGAGATATTCGAGGAGCGC
GTAAAGAGAGCTTCTTGCGTATTGCACAACTTCTGGAGGC
GCTCCATCCCGCAGATCATCACTGGAACAACACGCACAGG
CGCACGTGGATTCTGTTCTTTCTCTTTTGGCTTTTGATCA
TCGTTCGAGATGTTCGGGCACGATTTCTGCCTCGTGTCCG
CTTTGCTGTCGGTTGCCGATGCCGTCTTACCGACAGTGCT
GCTGCTCGCGGTCTCGCGGCTGCTTTGGGAGTTCAGGTGG
AGCATCACCCGGGACAGGACGTGTAAACTCCCACTCCCGC
AGGGATCCATGGGCTGGCCGCTGGTCGGAGAAACTTTCCA
CTGGCTTTTCCAGGGTTCCAGCTTTCACATCTCAAGACGA
GAGAAACATGGAAAGGTTTTTAAAACTCACCTTTTGGGCA
AACCTCTCATCCGAGTGACCGGTGCAGAAAACATCCGGAA
GATTCTGCTGGGTGAACATACGGTGGTCTGCACACAGTGG
CCCCAGAGCACACGAATCATCCTGGGACCCAACACTCTAG
TAAACTCAGTTGGAGATCTGCACAAGAGGAAAAGAAAAGT
CCTTGCTAAAGTGTTTAGTCGTGGGGCGCTGGAGGCATAT
CTTACTCGCCTTCAAGATGTCGTCAAGTCTGAAATTGCAA
AGTGGTGCACTGAGACCGGGTCTGTGGAGGTTTACACCGC
TGCCAAGTCACTCACCTTCCGCATCGCCGTGCGAGTCCTG
CTGGGTCTGCACCTGGAGGAGCAGCAAATCACTTATCTCT
CCAAAACCTTCGAGCAGCTCATGAATAATCTCTTCTCTCT
TCCTATTGACACTCCTGTTAGCGGCCTGCGCAAGGGAATC
AGAGCTCGTGAGATTCTGCACTCTGCCATGGAGAAGATCA
TAGAGGAGAAGCTGAAAAAACAGCAAGCCAGCGATTACTG
CGATGCTTTTGACTACATGCTGAGCAGTGCGAGGGAAAAT
GACTATGAACTTACAATGCAAGAACTCAAGGAAACGGCAG
TTGAGTTAATCTTCGCTGCCCACTCGACGACGGCCAGCGC
TTCAACATCCCTGATCATGCAGCTGCTGCGTCATCCAGAC
GTGAGCGAACGAGCCAGAGCAGAGCTGGAGAGCGAGGGCT
TGATCACTGATGGCCATGGACACTGCCGCTCTCGATGCAA
CGGGAATGCCATCAGTGAAGAAGGTGAAGCTGCGGAGAAG
AGCACCAGCGACCGGAGATCAGCGATCAATAAAGCAACTT
ATTTTGAAGCAGGAGACAAGGAGGAGGGCCGTCGCTCTCG
GACCCACGTCCCTTACCTGAGCTTGGAGAAACTGAGTCAA
CTTTCATACCTGGACTGCGTGGTCAAAGAGGTGCTTCGGT
TCCTCCCACCGGTGTCTGGAGGATACAGGACAGTTCTGCA
AACATTTGAACTGAACGGTTATCAGATCCCGAAGGGCTGG
AGCGTCATGTACAGCATCCGCGACACACACGAGACGGCAG
AAGCTTATCAAAACCCAGAGCTCTTTGACCCAGACCGTTT
CTGTGTGGGCCGAGAAGAAAGTAAAAGCGAGCGTTTTAGT
TACGTGCCTTTCGGAGGCGGTGTGAGGAGATGCATCGGCC
GAGAGCTGGCTTTGATTGTGCTCAAAACTCTGGCAGTGGA
GCTACTGGCCACAGCGGACTGCACTCTGGCAACCCAAACA
TATCCAAGGATGCAGACGGTACCAATTGTGCATCCAGTCA
ATGGACTGCATGTGTTTTTTAACTACAGAACCCAAGGGAT
TGAGAGAAACCGGAGGGAGTCCACGCACATATAAGCAAAT
AAATAAATAAATACATTACAAAAATCAAGTAGACACTGTA
CCACTTAGGACACTTATGCACAACCATCAGACTGCCTTTG
GAAACATAATGCTGGAATCATGCAGTTTTCTTTCTGGTGT
TTATGTAAAGCAAAAACACCTGGAAATCTGACAGAGTTGG
GTTAAAAAATATGGAGCCAGATCAGTCTCAAAAATCATTT
ATTTTTCTTTAGCTTAGTCTTCATTTTAGAAGTTGCCACA
GTGGAATGAACCACCAACTATTCTACCTTTTTTTTTTTTT
TTTTTAACGCAGTGGATGCTCTTGCAGCTGCAACCCAGTA
CTGGGAAACACCCATACACACGTACTCATACACTCCGAAC
GATTTAGCTTATTATGTCTTTTTAGACTGTGGTGGAAACC
GGAGCACCCGTAGGAAACCCAAGCCTACACGGGGAGAACA
TGCAAACTCCATGCAAAAATGCCAACTGGTCCAACCGGGA
CTCGAACCAGCAACCTTCCTGCTGTGAGGTGGCAACGCTA
ACCACTAAGCCGCCCTCCTCAAAAATAATACAATTACAAA
ATACACATTTCACATTTACAAAAAAGTTATTTGTAAATTC
AAACACAATTCATGAATGCACAAATCCAATTTGTAAATTC
AATACAATTCATAAAAACATGCCAATCCAATTATTAAATT
CAAAACACGTAAATACCCTAATCTAATTCATAAATTCAAA
ACAGTTTAAAAAATGTGCAAATTCGTAAATTAAACACACA
ATTCATGAATACGTAAATCCTATTCGCAATTCAAAACACA
ATTAATAAATGCACAAATCTAATTGGTAAATTCAAAACAC
AATTCATAAATGTGCAAATGCAATTCCCAAACTCAAAACA
ATTCATAAATACATAATCCAATTTGTAAATTCAAAACACA
AATTCAAATCATAAACTCAAAATAATTCATAAACGCGCAA
ATCAAATTCGTAAATTCAAAACACAATTCATAAAGGTGCA
AATCCAATTCGTAAATTAAAAATATAATTAATGAATACGT
AAATCCTATTCGTAGTTCAAAACACAATTCATAAATGTGC
AAATCTAATTGGTAAATTCAAAACACAATTCATAAATGCG
CAAATGCAATCGCAAACTCAAAACACAATTCATAAATACG
CAAATCCAATATGTACATTCAAAACACAATGCATAAATTC
AAATTACAGTACAATATATAAATGCACACGTGTAATTTAT
TTGGGGAAATATTTATTATTTTACATGTAAATTTACACAT
TGTGTTTTGAATTTACGAACTGGATTTTGTAAATATGAAT
TGCATTATGCATGTACGAGCTTGATTTTTGCAAATGTATT
ATTTCTGAGACTGATCTGGCTCCATAAAAAATTGGCTGAT
CATTAGAAAATGCTAAGCCTTCAATTCATTTTAGTGAACT
TGTAGAAAGGGTAAATATCCACCAAGATTCATGAAAAAGT
AACTTAAGCCTATGTAAAATGCAAACAAAGCTGTCGAATT
ACCAAGCTATTTTGATGTGCATGAGAACATCTTTAAAAAA
AAAGAGGGAAAAAAAAGAATAGAAACGCTTTTATTTCATT
TGTTTCATCTCAGCCTTGTATGTGATAAACAAAATCTGTT
TTTTTTTTTGTTTTGTTTTTTTAAATGAAGTAGGAACACA
AATAAGCTCTATTTATATGTATATTTCTCAAGTGTATAGG
AATAGCTCAGTAAATAAGAAATAATATTATGCCACTTTCA
AATTTCTAGGCCACTGTACTATAAATATGTACCGTTCTAG
TACTTACAGGAGTTAAATATTGCTTAAAACCACATAAATA
GAGGAGACTAATGCATAGCGATTGGTGTTTATTATGAATG
TAAGCTGTGAAAAATGATCCTTGCGCTGTGAACTGGGGAT
CGGTTTAAATACAGGGAAGGAGAAAACGAGCAGCACTTTT
TCTCCAAATTAGGAGTGTATGTACTTGTTTTGTCAATAAT
TGTGTGTAAGTTGTAGTTCCTGTACTCATGTTTGTCTTGT
CGAACAGTGCTCGTGTTAATTTTATATCTTTTATGGTATC
TATTTTGAAAGCTCTGCTATAATGTTTATAATGGTTCTGT
TCAATAAAGATATTTAAATGTGTTTATTTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations