Transcript

cdk5r1a-201

ID
ZDB-TSCRIPT-110325-2429
Name
cdk5r1a-201
Previous Names
  • cdk5r1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049840 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049840|OTTDARG00000035063|ZDB-GENE-080723-17 cdk5r1a|OTTDARP00000039102 cdk5r1a-001 LG_ BX890565.9 Danio rerio protein_coding KNOWN, 994 bp
GGCAGATTTCGTATCAAAAGACCCTGTAATAATAAAGGCA
ACATGGGAACTGTACTCTCAGTCTCCCCAAGCTACCGAAA
GGCAGGCCTGTTTGATGAAATACCACCCCCTCTGGCACAT
TATACAGCTGTGCAGAACAGTAAAAATGCCAAGGACAAGG
GTCTGAAACGCCAGTCGCTCATCAATGTCCTCCCATGGAA
GCGCATTGTGGCGGCTTCGGCCAAGAGAAAAGGCTCTAAG
AAGTTGCCCTCGGGTGACAGTCAAGATGAAGAGTGCGTGG
GCACTCTCAACAGCCAAAACCTGAAGAAGTCTCAGTCTTG
TGCCAATCTCTCGGGCTTCACCCAGGAGCCGGCTGTAAGC
TCCATTCCTACATCAAAAACAACCACCAATGTGACCTCCA
CCGCAAAGAGGACCCCCATCACTGAATTGGTGGCCCAAGC
AACCAATGCTGGCACACCCAAAAGAGTGATCGTGCAGGCT
TCCACCTGCGAGCTACTTAGAAATCTGGGCGACTTCTTGT
CGCGACGCTGCTACCGGCTGAAGCGATTCTCACCTGCCGA
GCCTATTGTCTGGCTTCGTCAGGTGGATCGGTCTCTTCTG
CTGCAGGGCTGGCAGGACCAGGGCTTCATCACCCCGGCAA
ACTTGGTCTTCCTCTATATGCTGTGCCGTGAGGTCATTTC
GCCAGAGGTGTCCAGCGAGCGTGAGCTGCAGGCCGAGGTG
CTCACTTGCCTCTACCTGTCCTACTCCTACATGGGAAATG
AGATTTCCTACCCGCTCAAGCCCTTCCTGGTGGAGATGGA
CAAGGACGTCTTCTGGAACCGCAGCCTGGACATCATCAAC
CGCATGAGTGGCAAAATGCTCCAGCTTAATTCTGACCCGC
ACTACTTTACACAGGTTTTCGCCGACCTGAAAAATGAACG
AGAAATAACAATAAGCCAGCTGTGTATTGGCTTGGATCGA
TAAGATGGCCGCTTGTGCATAGACAAAATAACTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations