Transcript

fabp7a-203

ID
ZDB-TSCRIPT-110325-2397
Name
fabp7a-203
Previous Names
  • fabp7a-003
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049691 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049691|OTTDARG00000034975|ZDB-GENE-000627-1 fabp7a|OTTDARP00000038981 fabp7a-003 LG_ CU306817.11 Danio rerio protein_coding KNOWN, 565 bp
GACTGAACTCAGCGACTGTACGAGCAGGACCACTGTGTGT
TTCATCATCTCTCAACATGGTCGATGCATTTTGTGCCACT
TGGAAACTGGTTGACAGCCAGAACTTCGACGAGTACATGA
AGTCACTGGGTGTTGGTTTTGCTACCAGGCAAGTAGGCAA
TGTTACCAAACCCACAATTGTGATCAGTCATGAGGGCGAT
AAAGTTGTGATAAAGACGCTGAGCACCTTTAAAAACACCG
AAATTTCCTTCAAACTGGGAGAGGAGTTTGATGAAACCAC
AGCAGACGATAGACATGTGAAGTCTACTGTATCCTTGGAA
GGAGACAATCTTGTCCAAGTTCAGAGGTGGGACGGCAAGG
AGACAAAGTTTGTCAGAGAAATCAAGGATGGTAAAATGGT
TATGTCCCTTTATTAATCCGGGGTCACCACAGCGGAATGA
ACCGCCAACTTATCCAGCAAGTTTTTACGCAGCGGATGCC
CTTCCAGCCGCAACCCATCTCTGGGAACAATTCATCATAT
ATTCATACCTTGACCTTTGAGGGAGTGCAGGCCGTGCGCA
CATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations