Transcript

fabp7a-201

ID
ZDB-TSCRIPT-110325-1489
Name
fabp7a-201
Previous Names
  • fabp7a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049690 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049690|OTTDARG00000034975|ZDB-GENE-000627-1 fabp7a|OTTDARP00000038980 fabp7a-001 LG_ CU306817.11 Danio rerio protein_coding KNOWN, 710 bp
ACTGTGGAGACTGAACTCAGCGACTGTACGAGCAGGACCA
CTGTGTGTTTCATCATCTCTCAACATGGTCGATGCATTTT
GTGCCACTTGGAAACTGGTTGACAGCCAGAACTTCGACGA
GTACATGAAGTCACTGGGTGTTGGTTTTGCTACCAGGCAA
GTAGGCAATGTTACCAAACCCACAATTGTGATCAGTCATG
AGGGCGATAAAGTTGTGATAAAGACGCTGAGCACCTTTAA
AAACACCGAAATTTCCTTCAAACTGGGAGAGGAGTTTGAT
GAAACCACAGCAGACGATAGACATGTGAAGTCTACTGTAT
CCTTGGAAGGAGACAATCTTGTCCAAGTTCAGAGGTGGGA
CGGCAAGGAGACAAAGTTTGTCAGAGAAATCAAGGATGGT
AAAATGGTTATGACCTTGACCTTTGAGGGAGTGCAGGCCG
TGCGCACATACGAGAAGGCATAATGTCCAGAGCGCAGGAC
GTTTCAGTATTACCCTGGCAACTTGACGATATTACAAGGG
AATTTTTATTACACTGTATTGTCATCTGGGAGTTTTCCCC
TTTTTTTGTAAGACCTTTTATATAAAACGCACATTGTGAG
TTGTTTTAAATGATGCAGAATGTCAATGATGGTGGTGGGG
GAGTGTATTATTGAGGCCTGCCTTTGTGTCAAATTGAAAG
AAATACACATTTGATCTAAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations