ZFIN ID: ZDB-TSCRIPT-110325-2305
Transcript Name: jupb-202
Previous Names: jupb-001, ch73-362f1.1-001, si:ch73-362f1.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049359 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049359|OTTDARG00000034792|ZDB-GENE-110407-10 jupb|OTTDARP00000038729 CH73-362F1.1-001 LG_ FP236357.7 Danio rerio protein_coding NOVEL, 2313 bp
CGCTGGAGGCCCCGCCCACTCGCGCGCTCCCGCAACCGGA
GACTCACGGAGGTTCCGCTGCTGTCAGACTCCGCCGCTCA
ACGCTTGCCAGACTTGGATAAGAGTGCACGGAGGGACTTG
GGGCCGGAGAAAGGATTCAGGAGCTACAATATCTGGAGTC
ATTCGCCAGTGGATTGTGTCCGTTCTGTGAGGCTCTGCTT
CCCCTGATGGTGTGACTTACGCTCAGATGCTTGATAAAGA
CGACGGAGCCGGATGGATTTTTGCTAAGATCTGTCAACAT
GATTGACGCTTGATTGAGGCCTGACAGTGGTGATGTCACT
GCAAATGAGTGAGGCTGATGGAGCAGTGAAGGTGGAGGAG
TGGCAGCAGAGCTTCTACACCGCAGACTCAGGCATTCAGT
CTGGAGCCACGACCATCAGGGATGAGGACGAGTCTGAGAG
CAGGAAGTACAGCGCTGGAGAGAGCAGCGCAGATATGGAG
GCTCAGTTCAGTCTGACTCGAGCTCAGCGAGTGCGTGCTG
CAATGTTCCCCGAGACCCTGGTGGAGGGAGAGACGGTTCT
CACACCGCAGAGCAACCCAGACCAGCCCACTAATGTGCAG
AGACTGGCGGAGCCCTCACAGCTGCTGAAGACTGCTATTG
TCCACCTCATCAACTACCAGGATGATGCAGAGCTGGCCAC
ACGAGCAGTGCCAGAGCTCACTAAACTACTGGCTGATGAT
GACCAGGTGGTGGTGAACAAGGCAGCGCTGATCGTGAACC
AGCTGACACGGAAGGAGGCGTCCCGCCGCGTGCTCATGCA
GTCTCCTCAGATGGTGTCGGCAGTGGTGAGGGCCATGCAG
AACACTGGAGACCTGGAGACGGCCCGCTGCGCTGCCAGTG
TTCTGCACAGCCTCTCACACCAGCGAGAGGGTCTGCTGGC
CATCTTTAAATCAGGCGGCATCCCTGCACTCGTGCGCATG
CTCAGTTCACCTATGGAGTCTGTGCTGTTCTATGCCATCA
CCACGTTACACAACCTGCTACTGCACCAGGAGGGAGCCAA
AATGGCGGTGCGCTTGGCTGATGGACTTCAAAGGATGGTT
CCCCTTCTGAAAAAGACCAACCCAAAGTTCCTGGCCATCA
CAACAGACTGCCTGCAGCTGCTTTCATATGGAAATCAGGA
GAGCAAGTTGATCATCCTGGCTAATGGCGGACCAGAATGT
TTGGTATTCATTATGAGAAACTACAACTACGAGAAGCTCC
TCTGGACCACCAGTAGAGTCCTGAAGGTGCTTTCTGTCTG
TCCAAGCAACAAGCCGGCAATTGTAGATTCTGGAGGTATG
CAGGCCCTCGGCCAACATCTCACAGGTTCGAGTCAGCGGC
TAACACAGAACTGCCTGTGGACCCTGAGGAATCTCTCTGA
CGCTGCAACCAAGCAGGAAGGTCTGGACGGTCTGCTGCAG
ATCTTAGTGAGTCAGCTGGGCTCTGATGATGTCAACATGC
TGACCTGCGCCACTGGCATCCTGTCAAACCTCACCTGCAA
CAACGCCCGCAACAAGGCCCTGGTCACGCAGAGCGGCGGC
GTGGAGGCGCTCATTCACGCTGTGCTCCGAGCCGGAGAGA
AGGAGGATGTAGCCGAACCCGCAGTCTGTGCCCTGAGACA
CCTCACCAGCCGCCATCCTGATGCTGAGCTGGCCCAGAAT
GCAGTGCGGCTGCATTACGGCATCCCCGCCATCACTAAAC
TCCTGGGTCAGCCGCACTACTGGCCTGTGGTGAAGGCTAC
AGTGGGTTTGATCCGTAACCTGGCGCTGTGTCCAGCCAAT
CAGGCTCCTCTACGGGAGTCCGGCGCAATCCCTCGACTAG
TCAACCTGCTGCTCAAAGCCCATCAGGAGACGCAGAGACA
TGGATCAGGAGCCCAGCAGACCTATCAGGACGGTGTGCGA
ATGGAGGAGATCGTGGAGGGCTGTACAGGAGCTCTGCACA
TTCTGGCCAGAGATCCAATGAACCGAGGGGAAATCGCCAG
CATGCAGACCATTCCTCTGTTTGTGCAACTGCTGTACTCA
TACGTGGAGAACATCAAGCGCGTGTCGGCCGGTGTTTTGT
GTGAACTGGCTCTGGATAAGCAGTCGGCTGAGATGATCGA
TGCTGAAGGAGCGTCTGCGCCTCTGATGGAGCTCCTGCAC
TCCCCGAATGAGGGCATTGCTACCTACGCCGCAGCCGTTC
TCTTCCGCATCTCAGAGGACAAGAGTTCTGACTACAGGAA
GCGAGTGTCAGTGGAGCTCACTCACTCCCTCTTCAAACAC
GACCCTGCAGCCTGGGACATGGTCAGTACAATC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jupb-202 Contained in:
[BAC] CH73-362F1 (1)

Genome Resources: Vega_Trans:OTTDART00000049359 (1),  Ensembl_Trans:ENSDART00000148794 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD756228 (1) 924 nt
GenBank:EE686197 (1) 786 nt
GenBank:BQ449777 (1) 621 nt
GenBank:EB899895 (1) 548 nt
CITATIONS (2)