Transcript

setx-202

ID
ZDB-TSCRIPT-110325-2300
Name
setx-202
Previous Names
  • setx-002
  • ch73-160g3.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049338 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049338|OTTDARG00000034777|ZDB-GENE-070402-1 setx|OTTDARP00000038712 CH73-160G3.1-002 LG_ CU927918.8 Danio rerio protein_coding NOVEL, 882 bp
GAAGAAGCAGTTTCTGAAAGAGAGAGAAGGACTGAGTCGG
CAGATTAAAGAGTGTCGCGGCAGAAGACAGGAGAGTCAAG
CTCTTGTCCTGCAGAATGCTCATGTGATCTGCTGCACGCT
CAGCACAAGTGGAAGTATTGTCCTCGAAAATGCCTTCCGA
CGTCTCGGACATGAGCCATTTAGCTGCGTCATCATCGATG
AGGCTAGTCAGGCTAAAGAAACAGAGACGCTGATTCCCAT
GCTGTACCGATGTCCTTCTGTAATACTTGTTGGCGATCCT
AACCAGCTTCCACCAACCGTTGTCTCCCAGAAAGCAAAGG
AGTTTGGCTTCGACCAGTCTCTGATGGCACGGTTATGCAA
AAGTCTTCACCCCTCAAACTCAAAACTCCCTCCAATTCTT
CTACTCAGTATGCAATACCGCATGCACCCAGACATCTGCG
AATTCCCTTCCAAGTACATCTACAACAGCGCACTCAAAAA
TGACTGGCAGGGCCAGTGCAGACAGGAGCAGGAGATTAGG
ACTGTGTCTGAATTCAGACTCCTCAGGTCATTGAGCGGAC
CGTGCGTGTGCGAGACTGCTCAGAAGCGCTGCTCCCTCAG
CTGGCCCTTCAAGCCCTACAAAGTGTTTGACGTGATGGAT
GGCAGAGAGACCAAGGAGAGAGACTCATTTATCAACCATA
AAGAGGTCAGTCTGGTGGGGCTGCTATTGAAGCTGCTGTG
TAAGGAGCAGGCGGTGCGAGTGGGTGTCATCACACCATAC
AACGCCCAGAAACATCGGATACTGGACGCCATCAAGACTT
CAGGCATCAACAAGCAGCTTCAGGTGGAAGTGGACACAGT
CGATGGCTTTCAGGGTAGAGAAATGGACTGTATTATTGTG
TC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations