ZFIN ID: ZDB-TSCRIPT-110325-228
Transcript Name: get4-201
Previous Name: get4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048338 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048338|OTTDARG00000034217|ZDB-GENE-030131-5399 get4|OTTDARP00000037924 get4-001 LG_ CU459216.5 Danio rerio protein_coding KNOWN, 1760 bp
GTCAATGTGAAGTACGGCGAGTCTGAAGGCTCAGTGATCG
CGTTCGGTTGGTCGGAGCAGTCATGTCGGAGCAGGAGTCT
CTGAAGAGCTCCAGCGCGAGGAACCGCGGAGGAGTACAGC
GAGTGGAAGGCAAACTGAGAGCCAGTGTGGAAAGAGGAGA
TTATTATGAGGCACATCAGATGTACCGCACACTATTCTTC
AGGTACTTGTCACAAGCAAAGCATGCGGAGGCCAGAGAGT
TGATGTATAATGGAGCGTTGCTCTTCTTTAGCTATAATCA
GCAAAACAGTGCTTCAGATCTGTCCATGCTGGTACTAGAG
TCCCTGGAGAAATCTGAGGCCAAAGTAGATGATGAAACAC
TAGAGCATCTGGCTAAACTTTTCAGCTTGATGGACCCAAA
TTCACCCGAGCGGGTGGCATTTGTCTCCAGAGCGATCAAG
TGGTCATCAGGAGGGTCAGGAAAGTTGGGCCACCCCAAAC
TACACCAGCTGCTGGCGCTCACATTGTGGAAAGAACAAAA
CTACAGTGAATCCCGTTATCATTTTCTGCGCTCATCTGAT
GGGGAAGGCTGTGCACAGATGCTGGTGGAGTATTCATCAG
CGCGAGGCTTTCATGGAGAGGTGGACATGTTTGTAGCACA
GGCCGTCTTACAGTTCCTTTGTCTAAAAAACAAGACAAGT
GCACTGGTGGTGTTCACCACATACACACAGAAACATCCGT
CTATAGAGAAGGGTCCTCCTTTTGTTCAGCCTTTGCTCAA
TTTCCTCTGGTTCCTCCTGCTGGCGGTGGATGGAGGGAAG
TTGACAGTCTTCACAGTGTTATGCGAGCAGTATCAACCAT
CACTGAAGAAAGACCCTATGTATAATGAGTATCTGGATAG
AATAGGACAGCTGTTTTTTGGAGTGCCACCCAAACAGTCG
TCATCATATGGTGGTTTGCTAGGAAACCTATTGAATAGCC
TAATGGGCTCAGGTGAGGAAGAAGATGGTGAAGAGGCTCA
CGAAGACAGCAGCCCCATTGAGCTGGACTGAAGCATCTGA
CTTCACGTCATAAACCAAACCATTCACTGAAGTGAACAAT
GACCAATCACGCATCCGTTTGGGCGCTCTTTTTCAAAACA
AAACTAACTCTTTCCTGTTATTGTTGGACTTTGTTCTGTG
TATAGTTTTTAAAGAATGAAGGTGCAACAATATCAAACGT
CCCGGACTGTTGAACAAAATTCATAAAAGAGCAGAAAGCG
ACGCACTTCAGATGTAATCGTGAACACCCTCCATTTGTAG
TTCTACTGAGCTTTTGGCGTCAGGGACCCTCATTTGTGAG
AGGGACCCTGATGGTACTTTGGCTGTCCTGCCACAGAGGG
TGGCGGCTGCTTTTCAATGTATTAATAAAAGTAATTCAAT
TACTCTTAACTTATAATCCATGCTAATATACTTTGATAAG
TCCTACAGTATGATCGCTCAAATCAAAACAAGGCTTGGTT
TTTTGTGTCCACACAGCTAGATCTTACCAGGGATACTGCG
GTGTCTTTGATAGGACTATTCACCACTTCTGTTACATCGC
GTGTGCGTGTATGTGTGTGTGTGAGAGGATGAGGAAAGCA
CAGCTCTCACTAATGTGTGCGAGACGTATAGACGAATGCA
TGTTAGTGTTGATCAGAGTGTGGATGTGTTGTTGTAAGTG
TATCGGTCACCAGTGGGCCGCTTCATTCTCTTCTGAGGTG
TGATTGAGCATAATTAAAGGATAGAGATGGATGTAACATA

get4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA get4-201 1760
get4-202 (1) 863
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
get4-201 Contained in:
OTHER get4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048338 (1)
  • Ensembl_Trans:ENSDART00000036989 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC049494 (1) 1881bp
    CITATIONS (2)