ZFIN ID: ZDB-TSCRIPT-110325-1136
Transcript Name: get4-202
Previous Name: get4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048339 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048339|OTTDARG00000034217|ZDB-GENE-030131-5399 get4|OTTDARP00000037925 get4-002 LG_ CU459216.5 Danio rerio protein_coding KNOWN, 863 bp
GCGAGCAGTATCAACCATCACTGAAGAAAGACCCTATGTA
TAATGAGGAAACCTATTGAATAGCCTAATGGGCTCAGGTG
AGGAAGAAGATGGTGAAGAGGCTCACGAAGACAGCAGCCC
CATTGAGCTGGACTGAAGCATCTGACTTCACGTCATAAAC
CAAACCATTCACTGAAGTGAACAATGACCAATCACGCATC
CGTTTGGGCGCTCTTTTTCAAAACAAAACTAACTCTTTCC
TGTTATTGTTGGACTTTGTTCTGTGTATAGTTTTTAAAGA
ATGAAGGTGCAACAATATCAAACGTCCCGGACTGTTGAAC
AAAATTCATAAAAGAGCAGAAAGCGACGCACTTCAGATGT
AATCGTGAACACCCTCCATTTGTAGTTCTACTGAGCTTTT
GGCGTCAGGGACCCTCATTTGTGAGAGGGACCCTGATGGT
ACTTTGGCTGTCCTGCCACAGAGGGTGGCGGCTGCTTTTC
AATGTATTAATAAAAGTAATTCAATTACTCTTAACTTATA
ATCCATGCTAATATACTTTGATAAGTCCTACAGTATGATC
GCTCAAATCAAAACAAGGCTTGGTTTTTTGTGTCCACACA
GCTAGATCTTACCAGGGATACTGCGGTGTCTTTGATAGGA
CTATTCACCACTTCTGTTACATCGCGTGTGCGTGTATGTG
TGTGTGTGAGAGGATGAGGAAAGCACAGCTCTCACTAATG
TGTGCGAGACGTATAGACGAATGCATGTTAGTGTTGATCA
GAGTGTGGATGTGTTGTTGTAAGTGTATCGGTCACCAGTG
GGCCGCTTCATTCTCTTCTGAGGTGTGATTGAGCATAATT
AAAGGATAGAGATGGATGTAACA

get4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA get4-201 (1) 1760
get4-202 863
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
get4-202 Contained in:
OTHER get4-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048339 (1)
  • Ensembl_Trans:ENSDART00000148850 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH610488 (1) 862bp
    CITATIONS (2)