Transcript

pltp-001

ID
ZDB-TSCRIPT-110325-2149
Name
pltp-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Sequence
OTTDART00000048860 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048860|OTTDARG00000034522|ZDB-GENE-040801-22 pltp|OTTDARP00000038345 pltp-001 LG_6 CU638700.5 Danio rerio protein_coding KNOWN, 297 bp
ACACACACTGCTACAGATACAACAGAGGAAACACTTGGAC
CTCCAGGGCTGGATATTTTCTTACACTTGAAAGGTCAGCT
GAGGAATCATGGGACTGCTAAAAGTGTCTGTCGTCTTTCT
ACTCTCACTCATCACAATGACATTAGCGGAGCCGCCTGGA
TGCAAGATCCGCATCACCAAAAAAGGACTGGAGATGTTGA
AGGCAGAGACCAAGAAGTTTGTGGAAGAAGAGCTGAGTAA
CATCACCATGCCAGAGATGCAAGGATCCGAGGGCCGTTTC
CAGTACACCATTAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations