ZFIN ID: ZDB-TSCRIPT-110912-181
Transcript Name: pltp-201
Previous Name: ottdart00000051899

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051899 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051899|OTTDARG00000036453|ZDB-GENE-040801-22 pltp|OTTDARP00000040782 pltp-002 LG_none CU638700.5,FP340256.6 Danio rerio protein_coding KNOWN, 894 bp
AGAGAGGATTGTAACTTTCACTGAAGACTTCAAGAAAATA
TCAGAGAGATTCTTGTGTCTTGAGTGATCCAGCCTGCATT
TCCACACCGCTGTCAGCTGAGGAATCATGGGACTGCTAAA
AGTGTCTGTCGTCTTTCTACTCTCACTCATCACAATGACA
TTAGCCGAGCCGCCTGGATGCAAGATCCGCATCACCAAAA
AAGGACTGGAGATGTTGAAGGCAGAGACCAAGAAGTTTGT
GGAAGAAGAGCTGAGTAACATCACCATGCCAGAGATGCAA
GGATCCGAGGGCCGTTTCCAGTACACCATCAATAATGTGA
GGATTATCGAGCTGAACCTGGCGTCTGACCTGCGCTTCCA
GCCGGATGTTGGTCTGCTGTTTGAGGTGCAGAACTCCTCC
ATCACCCTCAACTTCCAGAGACGCATCCTTTACTGGCTCT
TTTATGATGAGGGAGCCATCAACGCCTCAGCAGAAGGTGT
CAACATCTTCACCGTCCTTCATCTCAGCAAAGACGACGAG
GGTCGTCTGAAGATCTCCAACGTCACCTGTGATGCCTCCA
TCGCCAAGATGAGAGCCAAATTCAGTGGGACCCTCGGGAG
GGTTTATGACTTCATTGGGACGTTCTTGACTACAGGAATG
CGCTTCCTCTTAAATAAACGGATTTGTCCAGTCCTGAATC
ATGCTGCTCTAGTTTCTGTGAACCAGCTTCTGGAAACAAT
CCCAGTGCGTGCACAGGTGGACAGTTACATAGGCATCGAT
TACTCTCTGCTGAGTGACCCTGTGGTGACAGAAACCAGCC
TTGATATGGATTTCAGGGGCATGTTTTATGATCTTAAGAA
TGAGAACGACACTCTAGTGAACTACGCAGTGAATCCAGTA
GTGAGAGAGTATGA

pltp TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pltp-201 894
pltp-202 (1)    Ensembl 1832
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pltp-201 Contained in:
[Fosmid] CH1073-250A3 (1), ZFOS-1333D1 (1)

Genome Resources: Vega_Trans:OTTDART00000051899 (1),  Ensembl_Trans:ENSDART00000158219 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EV757455 (1) 947 bp
GenBank:DT868824 (1) 871 bp
GenBank:EE329790 (1) 860 bp
CITATIONS (2)