ZFIN ID: ZDB-TSCRIPT-110325-2129
Transcript Name: arhgef25b-201
Previous Name: arhgef25b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048740 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048740|OTTDARG00000034448|ZDB-GENE-080225-17 arhgef25b|OTTDARP00000038249 arhgef25b-001 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 2240 bp
AGAATGTGTGTCAGTGATTCAGAAAAAGCTGAGTGTGGAT
TAAACTGGACAGTACAGGACAGTAGAGAAGACAAAACACA
ACAATCAGCTATTTTCCGCCATTCATCTGGAGACAGAGAA
AGATGAAGAGTTTGGCCAAACTTCAAGGCAACACAGAGCA
ACTTCTGATGTCTTTATCAAACACCCTCCCATCTTTGACC
CTAAATAACCAGCAATGGATCCAGGAACAAAATGAAGGGT
GTCTTTTACTGGAAGAAAAACAGGGTTGTTCAAAGAAGGG
TGCAGGACCGGAAAATGAAAAACAAAGCTGGAACCAAAGA
CTCGAACACATACCTGAGGACAAAGACTCGTACACGTTAA
CTGGGCTCAGTGATGTCTCCTTGCCTCCAGATGATCCTCC
TTCAGCCTCTGTCTCCACTGATGACCTTTCTCCAATCTCT
CCCAGCAACCATCAGCTTTTTTCCAGCAGACGAGCATCTG
TCACATCCACCCGCTCCATCAAGGCCTTCAAGAGGTGGCT
GAGCAGCCCGGTTCGAAGGCTGAGTTTGGGAGGAGGAAAC
AAGAGTCAGAGTTCAAAGGGAATTCAGAGCCCAGAAGGGT
CAACCTACATGTTTCTTCCTCTCTCACCTGCTCAAAGCCC
ATTGAGCCCAATGGAGAAGTCCCAAAAACTGACCCGCTCC
TACAGATCTCTGGACTGTGGTGAACTTTCTAGAGAAACAT
CTCCTGACAGTCCCTATTACCCAAGATACCTCAATGATCT
CTTTCAGAGAAATCAGTCTTTTGATGTTCAAACTAGTGTC
AGTCCATCTTTGACTGACAAAACACTTGTAGAACAATCGC
AGAGCCTGGAGGACAATGAGCAACACAGAAGAACCGCTTT
AGAAAAAAGCATATATGTGCTGACAGAGCTGGTAGAAACG
GAGAAGCTGTATGTGGAAGATCTGGGGCTTGTTGTTGAGG
GTTATATGCTTACAATGAGAAGTTTTGGAGTGCCCGAGTA
TTTGGAAGGAAAGGACAAAATAGTCTTTGGGAACATTCAT
CAGATCTACGACTGGCATAAAGACTATTTTCTTGGAGAGT
TGGAGAAATGTGTGTCTGAACCCGACCTGCTAGCACAGCT
GTTTATTAAACATGAGAGACGGCTCAACATGTATGTTGTC
TACTGTCAGAACATGCCAAAGTCAGAGCACATCGTCTCAG
AGTACATCGAAACTTATTTTGAGGATCTGAGGCAACAGCT
GGGTCACAGACTGCAGTTAAATGACCTGCTCATCAAACCC
GTTCAGAGAATCATGAAATATCAGCTGCTGCTGAAGGACT
TCCTGAAGTACTACACTAAAGCGGGCAGACAAACAGAAGA
TCTTGAGAGGGCCGTTGAGGTCATGTGTTTTGTTCCAAAG
CGATGCAATGACATGATGAATGTTGGACGACTGCAGGGTT
TTGAGGGTCAGCTGAGAGCACAAGGGAAACTCCTGCAACA
GGACACCTTCACATTCATTGAGAACGAGAACAGCATCCTC
TCACGTCCCAAAGAGAGACGAGTGTTTCTTTTCGAGCAGC
TCATCATCCTCAGTGAGCCAATGGACCGCAAGAGAGGCTT
TTCCCTGCCAGGATACGTCTATAAAAACAGCATCAAGATC
AGTTGTTTATCCATTGAGGATCGCTGCCCAGAAGACCCCT
GTCGGCTGGTGCTGACATCTCGTAATATAGATGGAAGTTT
GCAAAAATTCATTCTCCGTGCATCCTCCTCAGAGATCAGA
ACGTCCTGGGCAAACGACATCATACAGATGCTAGAGACAC
AGCGCAACTTTTTAAACGCCCTGCAGTCTCCTATCGAATT
CCAGAGGAAAGAAATCAAATCCCTCAGTCTGGGAAAGAGC
ATGACAGCATCAGCCTCACTGAACTCTGGCCTGCGACCCT
ACAGCTCTGCTTCTATAGACCGTCAGACTCTGCCCTGCCT
GCAGTCCTGGCATTCCTCACAACCCTCGACGCCTCCCTGA
AAGCTTTCTGTTGGTCCTGCAGAGGCACTTTTTCATCTTC
CTTCGCACTCAAGATAAAGCAAGACCATTTTACATTACCT
GTGTCCAGAAAAAGACTGAATGGAGGAGGTTAAATTATTC
ATTTCTAATGATTTATAATGTGACTTAAAAGTTATACGAT
AATAAGTCATGTACTGTAAAGTTCAGGTATATGCATACAT
GAATTCTTGTAAAAAGAATTGTTCTTTTCTTCTTTCACTC

arhgef25b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA arhgef25b-201 2240
arhgef25b-202 (1) 716
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arhgef25b-201 Contained in:
OTHER arhgef25b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048740 (1)
  • Ensembl_Trans:ENSDART00000148531 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:GO942518 (1) 816bp
    GenBank:GO942517 (1) 811bp
    GenBank:CR927690 (1) 539bp
    GenBank:EB848893 (1) 529bp
    CITATIONS (2)