header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-314
Transcript Name: arhgef25b-202
Previous Name: arhgef25b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048741 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048741|OTTDARG00000034448|ZDB-GENE-080225-17 arhgef25b|OTTDARP00000038250 arhgef25b-002 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 716 bp
CTGATATGAAGGGGCATCGTGGCCCACGGGTATGTGGCTG
TTCACCCTTCTGTTGGAAGGTTTTGGCCAGGTGCGTGTGT
TGCTTCAATCAGAAAGACTCGTACACGTTAACTGGGCTCA
GTGATGTCTCCTTGCCTCCAGATGATCCTCCTTCAGCCTC
TGTCTCCACTGATGACCTTTCTCCAATCTCTCCCAGCAAC
CATCAGCTTTTTTCCAGCAGACGAGCATCTGTCACATCCA
CCCGCTCCATCAAGGCCTTCAAGAGGTGGCTGAGCAGCCC
GGTTCGAAGGCTGAGTTTGGGAGGAGGAAACAAGAGTCAG
AGTTCAAAGGGAATTCAGAGCCCAGAAGGGTCAACCTACA
TGTTTCTTCCTCTCTCACCTGCTCAAAGCCCATTGAGCCC
AATGGAGAAGTCCCAAAAACTGACCCGCTCCTACAGATCT
CTGGACTGTGGTGAACTTTCTAGAGAAACATCTCCTGACA
GTCCCTATTACCCAAGATACCTCAATGATCTCTTTCAGAG
AAATCAGTCTTTTGATGTTCAAACTAGTGTCAGTCCATCT
TTGACTGACAAAACACTTGTAGAACAATCGCAGAGCCTGG
AGGACAATGAGCAACACAGAAGAACCGCTTTAGAAAAAAG
CATATATGTGCTGACAGAGCTGGTAGAAACGGAGAAGCTG
TATGTGGAAGATCTGGGGCTTGTTGTTGAGGTTACA

arhgef25b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA arhgef25b-201 (1) 2240
arhgef25b-202 716
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arhgef25b-202 Contained in:
OTHER arhgef25b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048741 (1)
  • Ensembl_Trans:ENSDART00000148839 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN858789 (1) 728bp
    CITATIONS (2)