ZFIN ID: ZDB-TSCRIPT-110325-2018
Transcript Name: dlgap4a-202
Previous Names: dlgap4-003, dlgap4a-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048205 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048205|OTTDARG00000034144|ZDB-GENE-080219-51 dlgap4a|OTTDARP00000037831 dlgap4-003 LG_none CU929181.6,CU914614.5 Danio rerio protein_coding KNOWN, 2576 bp
GTGGAGCAGTGCTTCATGGCCAGCGCTGCTTACGGACAGT
TGGAGTCTCAGGCGGTGGAGGCTCTGGATCTTCCCACTCC
CACCTGCTTCCGGTCCAGGAGCCACAGTTACCTGAGGGCC
ATCCAGGCCGGCTGCTCGCAGGATGAGGACACTGGATCTG
TGGATTCAGACGAGACGCCGCCTATCACCTCCTCCATCAG
CAGCTGCAACAGCGTCACCGTCTCCACATGTACGGCGGTG
TGTAAGAAGAATCCTCCACCTGTTCCTCCACGCAACGCCT
CCAAACCCTACATCTCTGTCACTGTCCAGAGCAGCACCGA
ATCTGCGCAGGACACCTACCTAGACAGTCAGGACCAGCGG
AGCGAGGTCAACAGCCAATCAGGACGCAGCAACTCCTCCG
ACAGCCTCGCCAGCTCTCGGACAGGCAGTCTGGTGAAGGG
CTCCAAGCGGCCGCCCATCCTGCCGCCAATCCCTGCTCCG
CGGGAACCCGTACAGCTGCCCAGCGCCAGGGTGACCACAC
CCCCTCCTGCAATAGCCCCGCCCACTCCAGCCCCCGATGC
AAAACCCCAGCCCCTGAGCCTCACTCTGGTCCCAGACGAA
CCACAAGCTCCACCCAAGAGGAAGCTCTCATCCATTGGGA
TTCAGGTGGATTGTGTGCAGCCGATTCTGAAGGAGGAACA
AACCCCCACCACCAGGTTCCAGTCCATCGGGGTTCAGGTT
GAAGACGGCAGGCCACTCAGCCGCTTCACTAGCATGGCGT
CTAGACAGGAGACGACGGAGGCTGAATCTCAGGAGCAGTC
CGACGGTAAACATTTGGGAAATAAAACGCCCGGTCAATCT
TTGGACAAACCCTCCCTGGCGGACATGACCCGCTCTGCTT
CGACCTCGCTGCAGGAGAAGTTGGATCCAGCATTGGACCC
ATCCCGCCTCCCTCCACCAGACCCGTCTCTGCAGTCCGGC
AGCGGGAGCGTTAATGGAGCCGTAGAGCAGCCTGGGGGAT
CGGCCTGCCTCAGGGACGGGCGATGCTTTCAGAAGCTTCT
CCAGGCCGAAACCGACCGCATGGAGGCCTGGTGTCAGCAG
ATGGAGGAGGAGACCAAAGACAAGCAGCTGTCGGAGGAGG
TGTTAGGGAAGATCCGCAGTGCTGTCGGCAGCGCTCAGCT
CTTAATGTCGCAGAAGTTTCGGCAGTTCCAGGGTCTTTGT
GAGCAGAACCTGGATGTGAGTGCTCAGCCTCGGCCCACGG
CTCAGGATCTGGCAGGTTTCTGGGATCTCCTTCAGCTCTC
CATCGAGGACATCAGCATGAAGTTTGATGAGCTTCACCTC
CTCAGGTCCAACGACTGGAAGACGACTGACAAAAAGGAGG
AGAAGAAGTCTGCTCCATCGCACACACCAAAGAAGACGGT
GAAGGTGAAACCCAGCGGCGGGAAGGAAAAAAGCCTGGAC
TCTGTGGCTGACAAACAGCGTCAAGAAGCCAGAAAACGTC
TGATGGCGGCGAAGCGAGCGGTTTCTGAACGCCAGAATTC
CGCCACCGAGAGCGCCGAAAGCATCGAAATCTACGTTCCT
GAGGCTCAGACGCGACTCTAATAAAAAAAAAAAACACAAC
ATTAAAAACTCCAGGTCATGAAGAAACACTCAGAAACCGA
GGTCGGATTGAAAGCTGAAAACTTAATTGCAAAATGAAAA
ATACGTCAAAATGCAAGCAAATCGATTTTGAACGCTCAAG
CGCTGCCACAGAAGAACCTCCCGTTGACGTTCGTTTCTAC
GATTAACCTTGTTATAACTATAAATGTCCTAAAAAAGTGA
ATTATCTCATGGAATATATCAAGACTCTTGTCTGTAAATT
GTGCTAATAATATCTTAATAAGAGAAGACGTTCTTGAGAC
CCTTTACACGCGTCACATGATCCGCTATTTTCACTCGTCA
CATGACCCGCGGACGGCCAACGTACAGCATGCACTCAGGA
TCCGCACGTGTGCACTTGTCTTTCATCGGCTCAGTCTTCC
TGTTTTCTTCCTGCTTTTTGTTCTTCATCCGGAGCTCAAG
AGCGCCCCCTGTGGCCATTTCTAGCGACGTTTTCGACGGA
AAGCTCAAAATGTGAACGAATTACTATAGGAATTGGTAGA
ATAACACAGTTTTTTTATTATTATTAGCACTCCTCTAGTT
TTGTTTGTTTCATGTCATTATTCATTCCAGTAAAATTGAA
CGCAATTTAACGCATTTCAGCTTGTTTTATTTTTCGAACC
GGTTTCTTTAGTTAACAGGGATGAAATATGACCACTCGAA
CGTTGTTTTAAAATGACGAATGTTTAAGGAACGTGATGGC
GATGTCCAGATTTTTACTTGGACCCCGACAGCCTGTTTGT
TTTGTAATATTATTATTATTATTAATATTATGATTGTTTT
ATCTGTTGTTCATTCATTCATTCCATGTGTTTTCCAGCAC
ACGCTTGTGTTCAGATCAAGCCATGAACGTACAGCCGTGT
GTTTGTGTGACCAATTAGAGCCCTTCATTTGTGATCAGTT
GTTTTTTTTATCGTTATTTTTCTTTGTCAGATATTAAAAA
CCTCCGTTACCCAGAA

dlgap4a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript dlgap4a-203 (1)    Ensembl 2580
mRNA dlgap4a-201 (1)    Ensembl 2558
dlgap4a-202 2576
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dlgap4a-202 Contained in:
[Fosmid] CH1073-38K5 (1), CH1073-287N7 (1)

Genome Resources: Vega_Trans:OTTDART00000048205 (1),  Ensembl_Trans:ENSDART00000148500 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)