ZFIN ID: ZDB-TSCRIPT-110325-1110
Transcript Name: dlgap4a-201
Previous Names: dlgap4-001, dlgap4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048204 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048204|OTTDARG00000034144|ZDB-GENE-080219-51 dlgap4a|OTTDARP00000037830 dlgap4-001 LG_none CU929181.6,CU914614.5 Danio rerio protein_coding KNOWN, 2558 bp
CCCGCGTCCTGAAAGCGGATTACCGGATCGCTTCTTTTTC
CTCGACTCCTCGAGACGTGGACGGTGGATCCGCCGAACGG
AAACGATATCACAGCGAAACAACAGAGAACGACAAAACAC
ACTCGTTTCAGTCGGTTTTATGCGACGTAATGGAAGTACG
GCATCGACGGTGATCGCCTCACACACAGAGGAAGAGGAAA
AGTCTCCACATGTACGGCGGTGTGTAAGAAGAATCCTCCA
CCTGTTCCTCCACGCAACGCCTCCAAACCCTACATCTCTG
TCACTGTCCAGAGCAGCACCGAATCTGCGCAGGACACCTA
CCTAGACAGTCAGGACCAGCGGAGCGAGGTCAACAGCCAA
TCAGGACGCAGCAACTCCTCCGACAGCCTCGCCAGCTCTC
GGACAGGCAGTCTGGTGAAGGGCTCCAAGCGGCCGCCCAT
CCTGCCGCCAATCCCTGCTCCGCGGGAACCCGTACAGCTG
CCCAGCGCCAGGGTGACCACACCCCCTCCTGCAATAGCCC
CGCCCACTCCAGCCCCCGATGCAAAACCCCAGCCCCTGAG
CCTCACTCTGGTCCCAGACGAACCACAAGCTCCACCCAAG
AGGAAGCTCTCATCCATTGGGATTCAGGTGGATTGTGTGC
AGCCGATTCTGAAGGAGGAACAAACCCCCACCACCAGGTT
CCAGTCCATCGGGGTTCAGGTTGAAGACGGCAGGCCACTC
AGCCGCTTCACTAGCATGGCGTCTAGACAGGAGACGACGG
AGGCTGAATCTCAGGAGCAGTCCGACGGTAAACATTTGGG
AAATAAAACGCCCGGTCAATCTTTGGACAAACCCTCCCTG
GCGGACATGACCCGCTCTGCTTCGACCTCGCTGCAGGAGA
AGTTGGATCCAGCATTGGACCCATCCCGCCTCCCTCCACC
AGACCCGTCTCTGCAGTCCGGCAGCGGGAGCGTTAATGGA
GCCGTAGAGCAGCCTGGGGGATCGGCCTGCCTCAGGGACG
GGCGATGCTTTCAGAAGCTTCTCCAGGCCGAAACCGACCG
CATGGAGGCCTGGTGTCAGCAGATGGAGGAGGAGACCAAA
GACAAGCAGCTGTCGGAGGAGGTGTTAGGGAAGATCCGCA
GTGCTGTCGGCAGCGCTCAGCTCTTAATGTCGCAGAAGTT
TCGGCAGTTCCAGGGTCTTTGTGAGCAGAACCTGGATGTG
AGTGCTCAGCCTCGGCCCACGGCTCAGGATCTGGCAGGTT
TCTGGGATCTCCTTCAGCTCTCCATCGAGGACATCAGCAT
GAAGTTTGATGAGCTTCACCTCCTCAGGTCCAACGACTGG
AAGACGACTGACAAAAAGGAGGAGAAGAAGTCTGCTCCAT
CGCACACACCAAAGAAGACGGTGAAGGTGAAACCCAGCGG
CGGGAAGGAAAAAAGCCTGGACTCTGTGGCTGACAAACAG
CGTCAAGAAGCCAGAAAACGTCTGATGGCGGCGAAGCGAG
CGGTTTCTGAACGCCAGAATTCCGCCACCGAGAGCGCCGA
AAGCATCGAAATCTACGTTCCTGAGGCTCAGACGCGACTC
TAATAAAAAAAAAAAACACAACATTAAAAACTCCAGGTCA
TGAAGAAACACTCAGAAACCGAGGTCGGATTGAAAGCTGA
AAACTTAATTGCAAAATGAAAAATACGTCAAAATGCAAGC
AAATCGATTTTGAACGCTCAAGCGCTGCCACAGAAGAACC
TCCCGTTGACGTTCGTTTCTACGATTAACCTTGTTATAAC
TATAAATGTCCTAAAAAAGTGAATTATCTCATGGAATATA
TCAAGACTCTTGTCTGTAAATTGTGCTAATAATATCTTAA
TAAGAGAAGACGTTCTTGAGACCCTTTACACGCGTCACAT
GATCCGCTATTTTCACTCGTCACATGACCCGCGGACGGCC
AACGTACAGCATGCACTCAGGATCCGCACGTGTGCACTTG
TCTTTCATCGGCTCAGTCTTCCTGTTTTCTTCCTGCTTTT
TGTTCTTCATCCGGAGCTCAAGAGCGCCCCCTGTGGCCAT
TTCTAGCGACGTTTTCGACGGAAAGCTCAAAATGTGAACG
AATTACTATAGGAATTGGTAGAATAACACAGTTTTTTTAT
TATTATTAGCACTCCTCTAGTTTTGTTTGTTTCATGTCAT
TATTCATTCCAGTAAAATTGAACGCAATTTAACGCATTTC
AGCTTGTTTTATTTTTCGAACCGGTTTCTTTAGTTAACAG
GGATGAAATATGACCACTCGAACGTTGTTTTAAAATGACG
AATGTTTAAGGAACGTGATGGCGATGTCCAGATTTTTACT
TGGACCCCGACAGCCTGTTTGTTTTGTAATATTATTATTA
TTATTAATATTATGATTGTTTTATCTGTTGTTCATTCATT
CATTCCATGTGTTTTCCAGCACACGCTTGTGTTCAGATCA
AGCCATGAACGTACAGCCGTGTGTTTGTGTGACCAATTAG
AGCCCTTCATTTGTGATCAGTTGTTTTTTTTATCGTTATT
TTTCTTTGTCAGATATTAAAAACCTCCGTTACCCAGAA

dlgap4a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript dlgap4a-203 (1)    Ensembl 2580
mRNA dlgap4a-201 2558
dlgap4a-202 (1)    Ensembl 2576
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dlgap4a-201 Contained in:
[Fosmid] CH1073-38K5 (1), CH1073-287N7 (1)

Genome Resources: Vega_Trans:OTTDART00000048204 (1),  Ensembl_Trans:ENSDART00000086156 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC160618 (1) 2088 nt
GenBank:BC124433 (1) 1551 nt
GenBank:BC133918 (1) 1531 nt
CITATIONS (2)