ZFIN ID: ZDB-TSCRIPT-110325-1895
Transcript Name: lim2.5-201
Previous Names: lim2-001, lim2.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047802 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047802|OTTDARG00000033903|ZDB-GENE-050320-94 lim2.5|OTTDARP00000037526 lim2.5-001 LG_ CU855686.17 Danio rerio protein_coding KNOWN, 1108 bp
ATCATGGTTGCGTTCGCCGGAGTGTCACGCTGGATCCGGA
GAGCAGGCCTGAATGAAAGTGTGCGCTTCAGCATGTTGCA
TTGACCGGCGCAGTACTGCAAGCCTCTGCACATCACAGTT
CCAGAACGGCCAATGCAACAACAAAGAGAGCGTCAGGACG
AGCGTCCCCGCGTGCCTCCGACACCATCAAGCTGAAGTGC
ATTTGTTCTGTGTGGCTCGCTCTAAAGGATTTTGCCACCA
TCGACAGAAAAAGCAGAGGGCATAACTTTTTGGAAGTGGG
CCTGGCGGATCCTTTTTGACGTTCGGCTCACTGCGGGATA
CACTTTCTCTCTCTTTTCCTCTGGGAAGGTCAATACTTGA
GCAGCTTCATTTATCCTGAAGACTTCAGGATGTACAGCTT
CATGGGAGGGGGTTTGTTTTGTGCCATCGTGGGCAACATC
CTGCTGGTTGTTTCCACTGCTACCGACTACTGGATGCAGT
ACAGACTGTCAGGCAGCTTCGCTCACCAGGGCCTGTGGAG
ATATTGCATGTCTGGCAAATGCTACACACAGACTGACAGC
ATCGCGTACTGGAATGCAACACGGGCCTTCATGATCCTGT
CAGCCATGTCGTGTTTTGCTGGAATAATCGCAGGAATCCT
CTCCTTCGCTCACTTCTCCGCCTTCGAGAGGTTCAACCGT
TCCTTTGCAGCAGGAATCATGTTTTTCATTTCCACTCTGT
TTGTTCTGCTGGCGATGGCCATTTACACCGGCGTGACTGT
CAACTTCCTGGGAAAGCGTTTCGGGGACTGGAGATTCTCC
TGGTCCTACATTCTGGGCTGGGTTGCTCTGCTCATGACCT
TTTTTTCAGGTATTTTTTACATGTGTGCCTACAGGATGCA
TGAATGCAGAAGAGTGGCCGGCACTCGCTAAAACCAGAGA
CAAGCAAACATTCATCACCCAAGTATTTGATTATCTGATC
CCACTTATAAAATACAGAGAAAAAAGACACTGTCAGATTT
CACTAGTTGCAATAACAACAGAACTCATTTAAGATTTGAA
TCACTTGAATGAACTGAAGCATTTTTCATGCACAGAGTGA
AAAATCTCTAATAAAATCTGTTCTCTTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lim2.5-201 Contained in:
[BAC] CH211-231M23 (1)

Genome Resources: Vega_Trans:OTTDART00000047802 (1),  Ensembl_Trans:ENSDART00000148478 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN511531 (1) 859 nt
GenBank:EH436561 (1) 817 nt
GenBank:BC164888 (1) 589 nt
CITATIONS (2)