Transcript

lim2.5-201

ID
ZDB-TSCRIPT-110325-1895
Name
lim2.5-201
Previous Names
  • lim2-001
  • lim2.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047802 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047802|OTTDARG00000033903|ZDB-GENE-050320-94 lim2.5|OTTDARP00000037526 lim2.5-001 LG_ CU855686.17 Danio rerio protein_coding KNOWN, 1108 bp
ATCATGGTTGCGTTCGCCGGAGTGTCACGCTGGATCCGGA
GAGCAGGCCTGAATGAAAGTGTGCGCTTCAGCATGTTGCA
TTGACCGGCGCAGTACTGCAAGCCTCTGCACATCACAGTT
CCAGAACGGCCAATGCAACAACAAAGAGAGCGTCAGGACG
AGCGTCCCCGCGTGCCTCCGACACCATCAAGCTGAAGTGC
ATTTGTTCTGTGTGGCTCGCTCTAAAGGATTTTGCCACCA
TCGACAGAAAAAGCAGAGGGCATAACTTTTTGGAAGTGGG
CCTGGCGGATCCTTTTTGACGTTCGGCTCACTGCGGGATA
CACTTTCTCTCTCTTTTCCTCTGGGAAGGTCAATACTTGA
GCAGCTTCATTTATCCTGAAGACTTCAGGATGTACAGCTT
CATGGGAGGGGGTTTGTTTTGTGCCATCGTGGGCAACATC
CTGCTGGTTGTTTCCACTGCTACCGACTACTGGATGCAGT
ACAGACTGTCAGGCAGCTTCGCTCACCAGGGCCTGTGGAG
ATATTGCATGTCTGGCAAATGCTACACACAGACTGACAGC
ATCGCGTACTGGAATGCAACACGGGCCTTCATGATCCTGT
CAGCCATGTCGTGTTTTGCTGGAATAATCGCAGGAATCCT
CTCCTTCGCTCACTTCTCCGCCTTCGAGAGGTTCAACCGT
TCCTTTGCAGCAGGAATCATGTTTTTCATTTCCACTCTGT
TTGTTCTGCTGGCGATGGCCATTTACACCGGCGTGACTGT
CAACTTCCTGGGAAAGCGTTTCGGGGACTGGAGATTCTCC
TGGTCCTACATTCTGGGCTGGGTTGCTCTGCTCATGACCT
TTTTTTCAGGTATTTTTTACATGTGTGCCTACAGGATGCA
TGAATGCAGAAGAGTGGCCGGCACTCGCTAAAACCAGAGA
CAAGCAAACATTCATCACCCAAGTATTTGATTATCTGATC
CCACTTATAAAATACAGAGAAAAAAGACACTGTCAGATTT
CACTAGTTGCAATAACAACAGAACTCATTTAAGATTTGAA
TCACTTGAATGAACTGAAGCATTTTTCATGCACAGAGTGA
AAAATCTCTAATAAAATCTGTTCTCTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations