Transcript

pabpc1a-006

ID
ZDB-TSCRIPT-110325-1888
Name
pabpc1a-006
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047723 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047723|OTTDARG00000033855|ZDB-GENE-030131-3238 pabpc1a|no_translation pabpc1a-006 LG_ CU855877.4 Danio rerio protein_coding KNOWN, 747 bp
GACATGATGACCCGCCGCTCGCTAGGTTATGCCTATGTCA
ACTTCCAGCAGCCCGCAGACGCCGAGCGTGCTCTGGACAC
CATGAACTTTGACGTGATCAAGGGTCGCCCCGTGCGCATC
ATGTGGAGTCAGAGAGACCCGTCGCTGAGGAAGAGCGGTG
TGGGTAACATCTTCATCAAAAACCTCGACAAATCCATCGA
TAACAAGGCGCTGTACGACACCTTCTCCGCCTTCGGGAAC
ATCTTGTCCTGCAAGGTGGTGTGTGATGAGAACGGCTCCA
AAGGATACGGCTTTGTGCACTTTGAGACCCACGAGGCCGC
AGAAAGAGCCATCGAGAAAATGAACGGCATGTTGCTCAAT
GACCGCAAAGTGTAAGTGTGCTTTTCAATTAACCTGCATT
TACTCACTGATGTGTGTGGAGTAAACCCCATGCACAAACA
CTTAAATCACATCCTGAAGTTGGCTGCCACTCAGGATGTG
ACGCCTGATATTGATGCGCTGTTGAAAGCTAAAAGATGTC
AGGTATCAGGACAAAGCTGTTAATAACAACCTGTATGCTA
ATTGGGATGCAGCTCATGTGTTTTTCCGTGTTTTCCTCAG
GCTGTGGATGAGATGAATGGGAAAGAGATGAACGGGAAGC
AGGTTTATGTGGGCCGAGCGCAGAAGAAGGGAGAACGGCA
GACAGAGCTCAAGCGCAAGTTTGAGCAGATGAAGCAGGAC
CGCATGACGCGCTACCAGGTGAAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations