Transcript

abcb7-201

ID
ZDB-TSCRIPT-110325-1868
Name
abcb7-201
Previous Names
  • abcb7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044735 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044735|OTTDARG00000032081|ZDB-GENE-050517-10 abcb7|OTTDARP00000035394 abcb7-001 LG_none CR812849.15,AL954179.9 Danio rerio protein_coding KNOWN, 2744 bp
ACAAGTGACGTTCTCTCAACCCTTCAGTTCAGCATGGCGC
CGCTCTTGGTACCGCTGAAATGTGGATTTCACATGCAAAG
GCGCAAATTATCCCTGCTACTTCAGCGGAGCAGCGCTGTT
CAAGCATGGACCTTTCACGACCATAGAGCGGCTAATAAAC
GGAAAGAGCGGAACACGTATCTGTTGTCAGACCCAAGCAG
AGAGTCCTCAACATGGGCCAACAACAGAGGCCAGAACAGC
CAACAGATTCTAGAAGCTGTCAAACATTTACATCTACAAG
AGAGGCAGTGCTGGCATGGGAACGCAGGTGGTGGGCTCAG
TGCAGATCCCAAAAATGTGCTGAAGGAAGTGAATTCATCA
AAGATTCTTGGAGCCATGTTTACATATGTTTGGCCCAAGG
ACAGACCAGACCTCCGGGCTCGTGTGGTCATATCTCTGAG
TCTGCTTGCTGGAGCTAAGATAACCAACGTGATGGTGCCC
TTCATGTTTAAATATGCGGTGGACAGCCTGAACCAGATGT
CGGGACACATGTTAAACCTGAGTGATGCGCCAAACACGGT
GGTGACCATGGCAACGGCTGTTTTGATTGGCTATGGTGTT
TCCCGCACTGGATCGGCTCTCTTTAATGAACTCAGAAATG
CCGTGTTTGGAAAAGTGGCACAGAGCTCCATCAGGAGGAT
AGCCAAGAATGTGTTTCTCCATCTTCATAACCTGGATCTG
GGCTTCCACCTGAGCAGGCAGACAGGAGCGCTGTCCAAAG
CAATCGACCGCGGCACTCGAGGAATCAGCTTTGTGCTCAG
CGCACTGGTCTTTAACCTGGGGCCTACTCTTTTTGAAATG
ATGCTTGTCAGTGGCATATTGTATTATAAATGTGGAGGTC
ACTTTGCTCTGGTCACTCTAGGAACTCTTTCGGCATACAC
TGCCTTCACAGTCGCTGTTACACAATGGAGGACGCAGTTC
AGGATTGAGATGAATAAGGCTGATAACGAGGCGGGAAACG
CTGCTATCGATTCTCTCCTCAATTATGAAACTGTCAAGTA
TTTCAACAATGAGAAGTATGAGGCAGAGCGTTACGATGGG
TTTCTGAAGGTGTACGAGTCATCCTCTTTAAAGACTACCT
CTACTTTGGCCATGCTCAACTTCGGTCAGAGCGCCATCTT
CAGTGTCGGACTCACTGCTATTATGGTGCTGGCAAGCAAA
GGCATAATGTCAGGGACCATGACTGTGGGAGATCTAGTGA
TGGTGAACGGGTTGCTCTTTCAGCTCTCTCTGCCACTCAA
CTTCCTGGGCACTGTGTACAGAGAGACCAGACAGGCTCTC
ATAGACATGAACACACTCTTCACACTGCTCAGCGTGGACA
CTAAGATAAAGGAGAAAGAAATGGCCCCACCGCTGATCGT
TACACCTCAGGAAGCCACCATCAGATTTGAGGATGTGTAT
TTTGAGTATTTGGAAGGACAAAAGGTGCTTAACGGGGTTT
CTTTTGAAGTACCTGCAGGGAAAAAGGTGGCCATTGTTGG
TGGCAGTGGATCTGGGAAGAGCACAATTGTCAGATTGCTG
TTTCGATTCTATGAACCACAGCAGGGAAACATCTATATCG
CAGGCCAGAACATTCGTGATGTTGGTTTAGAGAGCTTGAG
GAAAGCTGTGGGTGTTGTACCACAGGATGCTGTGCTTTTC
CACAATACCATATTTTACAATCTGATGTATGGCAATATCA
ATGCCACAGCAGAGGACGTTTACCGTGTGGCCAGACTTGC
TGGAATCCATGATGCCATTCTCAAAATGCCTCATAAATAC
GACACACAGGTCGGAGAACGAGGCTTGAAGCTCTCAGGCG
GAGAAAAGCAACGCGTGGCCATTGCACGGGCAATTCTTAA
GAACCCTCCCATCTTGCTTTACGACGAGGCCACATCTTCA
CTAGACTCAGTCACTGAAGAGAATATCCTGACTTCCATGA
AGGAAATGGTGAAGGACAGAACATCTGTCTTTATTGCACA
CCGGCTGTCCACCATTGTGGATGCAGATGAGATTATTGTA
CTAAATCAGGGGAAGGTGGCAGAGCGTGGAAATCATCAAA
CTCTTCTGGACACACCGGGCAGCCTGTATGCCAACCTGTG
GAATACACAAAACAGCCGAATTCTGAGCAACGGAAGCAAG
CCTGAGCCTGTGCCCGAGCGCGTGTCGCAGAAAGAAGAGG
AGCGCAAGAAGCTGCAGGAGGAGATCATGAACAGTGTGAA
GGGCTGCGGGAACTGCTCGTGCTGAGTCCTGTCCAGACCT
GCTTCAGAAACCACCTGCCAGCCTTTCAAACCATCCCGGA
GATGTCCACCGCTGGTGAGTGGACTGCTAGAATATTATTG
AGAGGGTTATCTTTCCTCTTATGGGACATATACTCGTAGG
CCAAAGTGATGCCTTTATCTTCATGTTATCATGGTGTTTT
GAACTTGTTTTAAAAAGATGTGTCCGCTTCATCTGGAACT
CTTGTAAGCTGTTTTTATTATGGGATTGTATATATTACTA
ATGCAATATTTTTGATCGAAAGTGCAGAGAGGCACATTGT
ATAGAGTGCACATATCATCAGATAGAGATTTTGTCCTTTG
AAGCTTGTTAGGTGTGGACCATTTGGAATTGTGAACACCG
GCACCTTTGACGTCTCCAAGTTAACCAACATTAATTTATA
CCAAATCTAAGTGTGATTGTACATTTAACAACTTGTATTA
AATAAATGACTACATCGAGTGTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations