header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1819
Transcript Name: zgc:174259-202
Previous Names: ch211-186e20.4-001, zgc:174259-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019877 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019877|OTTDARG00000016533|ZDB-GENE-080213-10 zgc:174259|OTTDARP00000016801 CH211-186E20.4-001 LG_ CR559930.6 Danio rerio protein_coding NOVEL, 1505 bp
AAGATCAAACAAACTGTAAGAGCACAGGCTTTATAACTCA
GTCTAGTTTAAGAAAAGAGGAACAACAGCTGTCTGAAGAG
AGACTTCAAGACCATGGAACAGAACGGTGTATTTTTGTGG
ATTTGTGGTTTTGCAATAGTTGTCTGTGGGAATCAAGAGA
CTTTACAACAACCTCCCATTAGCGCTAAACTCCCGTCATT
GATAAACATGAACAACGATTTTGCTTTTCACCTGTACAAG
AGGCTTATAGAATCGCCTGACTATCAGTCTAAAAACATCT
TCTTCTCTCCGTTCAGTGTGTCTATGGCCCTTTCTGAGCT
TTCTTTAGGAGCCGGTGGAGACACCAAACAGCAGCTTCTC
AGTGGCATTGGCTACAGTAGTGCAATCTTCAGCACTGAGG
AAATGCACCAGCTGTTTCACAGTCTCCTGGAAGACATCGG
CAATAGGACAGGAGTGGACATCGATGTTGGCACTGCTCTT
TATGCAAGCGACCGATTTAAGCCTCATTCCAAGTTTCTGG
AGGACATGAAGGAGTTTTACCACTCTGATGGCTTCACTGT
AGATTTTAGTGTCAAAGAAACAGTCGATCAAATTAATAAA
TATGTGGAGGAAAAAACACATGGAAAAATCAATCAAGCTG
TTGATGATCTGGATGCGGATACTTTTATGGTACTTCTCAC
ATACATATATTTTAAAGGAAAATGGGACAAGCCTTTTAAC
CCAAAAACAACCAGCGAGAGTACATTTCATATAGATGATA
AGACCACCGTTCCAGTGCAAATGATGCATCAGTATGAACG
TCTCAAAGTCTATTATGATGCTGAACTGTCCACTAAAGTC
CTCTGTCTTGACTACAACGATTCCTTCTCCATGTTTCTGG
CTGTCCCAGATGTTCACATGGGGCGAAAAACCATCAAAGA
TCTAGAGATGACAGTCTCTAGACAGCACGTTGAAAAGTGG
AGGAGAAGTGTATCTGAACGAAAAGTTGACATCTACGTCC
CCAAGCTTTCTCTGAAAACATCATACTCCCTAAAGGATAT
TTTGAAGGGAATGGGAATGGCTGATATGTTTTCAGATAAA
GCCGACTTTACAGGAGTTTCAGAGGAAAAGATCTACGTTT
CAAAAGTTTTGCATAAAGCCACTCTGGATATCGATGAGAA
AGGAACCACCGCAGCAGCAGTGACAACAGTTCATTTAAGA
TTTATGTCCTACAGCCCAATGAGTGATTTGAGTTTTGATC
GCCCATTCATGATCTTTATCACGGATCAAACAAATGACAA
CATCCTTTTCGTTGGGAAAGTGGTCAACCCAAATGAAAAA
CTATGATGTGGCCCACAAGATGTTAAAACAATGTTAACCA
GTAGGTGGAAACCATTTAACAACTGCTGTGCCATATATTG
CTGACTTCCTGCAGAGTTCAGTTCTTATTGTTATAAAACA
GCTGGATCAGCTAATGTAGGTGATGGTGGGAAATAAAATG
CAAAAAACTGGACTTGCAACACAGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174259-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000019877 (1),  Ensembl_Trans:ENSDART00000149563 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC096945 (1) 1489 bp
GenBank:EH500881 (1) 1013 bp
GenBank:EH523015 (1) 873 bp
GenBank:EH496712 (1) 823 bp
GenBank:EH527109 (1) 741 bp
CITATIONS (2)