Transcript

traf4a-201

ID
ZDB-TSCRIPT-110325-1779
Name
traf4a-201
Previous Names
  • traf4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051033 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051033|OTTDARG00000035815|ZDB-GENE-040308-1 traf4a|OTTDARP00000040110 traf4a-001 LG_none CR855391.6,CR848661.5 Danio rerio protein_coding NOVEL, 3072 bp
GCGCTGTGGATGTTTCTCGTCCTCTCGGTTCATCAGCGAG
CTCTAGCCTGCATTGACAGCCTCGTCGCCGGGTTTAAGCT
GTCATCCTGACCGAGCCGTGTTGCTCGAAAAGAGGAAGCC
GAGAGAAGAAACAATACCGAGGGTTGTGTGCCGTTGGCAA
GTGAAGATCAGTTTTCAATACGCGGACTCTTGTTATTGCG
GTGGAAAACAAACGACAGCTCCTATAGACGCTCCTCACTG
AAGCAGCAGCAATGCCTGGCTTTGACTACAAGTTCCTGGA
GAAGCCCAAGAGACGCTTTCAATGTCCTCTGTGTAGCAAA
GCAATGAGGGAACCGGTCCAAGTTTCCACATGTGGACACC
GATTCTGTGATACCTGCCTGCAGGAATTTCTCAGTGAGGG
GGTCTTCAAGTGCCCGGAGGACCAGCTCCCATTGGATTAC
GCCAAGATCTATCCTGACCCTGAGCTGGAGCAGCAGATAC
TGGCGCTGCCCATCCGCTGTATTCACAGTGAAGAGGGCTG
CCGCTGGACCGGCCAGATGAAACAGCTACAGAGCCACTTC
TCGACCTGCGCCTTCAATGTGATCCCCTGCCCAAACCGCT
GCTCCGTCAAGCTGACGCGCAGAGACCTGCCCGAACACCT
GCAACACGACTGTCCCAAACGCAAGGTCAAGTGCGAGTTC
TGCGGGAGTGAGTTCACAGGAGAGGCCTATGAGAACCACC
AAGGCATCTGTCCGCAGGAGAGCGTTTACTGCGAAAACAA
GTGTGGCGCAAGAATGATGCGGCGACTCCTGTCCCAGCAC
ACCATGACGGAGTGTCCCAAACGCACACAGCCCTGCAAAT
ACTGTGGCAAAGAGTTTGTGTACGACACAATCCAGAACCA
CCAGTATCACTGCCCTCGCTTCCCAGTGCAGTGCCCCAAT
CAGTGCGGCACCCCGAACATCGCCCGTGAGGACCTGGCCA
ACCACGTGAAGGAGAGCTGCGGCAGTGCGCTGGTCCTCTG
CCCATTCAAAGAGGCCGGCTGCAAACACAGATGCCCAAAG
ATGGCGATTGGTCGGCATCTGGAAGAAAGCACTAAATCCC
ACCTGACCATGATGTGCAGTCTCGTGGGACGCCAGAGGCA
GGAGATCTTGGAGCTCAGACGCGAAATGGAGGAGCTCTCG
GTCAGTCACGATGGCGTCCTTATCTGGAAACTGACTGACT
ACTCACGCAAACTGCAGGAGGCCAAACTGCGCAACAACCA
CGAGTTCTTCAGTCCACCTTTCTACACGCACCGCTACGGG
TATAAGCTTCAGGTGTCTGCTTTTCTAAATGGCAACGGCA
GTGGTGAAGGCTCGCATCTGTCCATATACATCCGCGTGCT
GCCCGGAGAATACGACAACCTGCTCGAGTGGCCCTTCTCA
TACAAGGTGACCTTCTCCATCCTCGACCAGAGCGACCCGT
CACTATCCAAACCCCAGCACATCACCGAGACCTTCAACCC
GGACCCCAACTGGAAGAACTTCCAGAAGCCCTGCAGCAGC
CGCAACTCGCTGGACGAGAGCACGCTGGGCTTCGGCTACC
CCAAATTCATCTCGCACGAGGAGATCAAGAAGAGGAACTA
CATCCGCGACAACTCCATCTTCCTCAAAGCTTCCATAGAG
ATCCCGCAAAAAATCATGGCCTGAGGGGTGAACATTTGTG
TTGACGTTTTGTTTTATCCCCTCACAGAGCCCGTCTGTTT
GGTGAATCGGCCAGATTTGAGGAGCCGTACCAAAATATGG
AAGTGTTTCGCAAAGTCATCTCTTGGATTTGCTTTCTAAC
ACTATTCTTCCTCAGTCTACAGCAACGCCTTTGGACATTC
AGTAGTGCCTAGAACATTTGTTTTAATTCAACTGTTATTT
CTGGACTGTGAAAGGCTATTCCTAACCTTTTGAGATTGAC
AAGACGTACACTAACCCTCTTTCTACCCCGTTGAAAAATG
GGTGTGAGCTCAACTGAACGTAGATTCAACTAGTTTAAGT
AAACTAACAACGGCTGTGAACTAAATGTAGCTTAACTCGT
TCGACTCCACGGTGCATTGTAGTACTTGCGTTTTTTTCAA
CACTAGTCGACGTTTGAGATGATTCCGAGCATGGCATTTT
TGTCTAGCTTTTTTTTAATCCTTATCGTATGATGGAAATC
AAACTCATGCAGTCGGATTCGGATCGAAAGCCATTGCGAG
AGATTGTTTACATTCAGTTAGAGGGGGGAGATTCATTCAT
GGACCAGTTCTGTTGTTTTGTACTGTATCCTGTATTCTTA
ACCAGCGTGTGAGGGCTTGACGGTCGGATGAGCGAAAGGA
ACCAAAAGTTTTTGATATGTGAAAAATATAAATGTGAGCA
GCATTGTGTCACAAAGCGAGGAGGATTTCGAATGTGAACT
CTGGACTCGACATGCTCAGTTCTTTGTCTTGCTGTGGTGG
ATGATGAACCGAGAAATGAGCGGCGCTGGTAGTTTGGCTT
ACCTGTGCCTGGTAAAGCAGCATGTGAGCAAGTGGAGAGT
TCTTCCATGTGCCTGAGGAAGATGAGCCTTGTGCAATATG
GCTGCCATTGCTCCATACAGACCAGTGGAGGACTTTTTGT
TGATCCTTATTATTATAATATATTATATGTGAATACTAAT
AACGAAAAAAAAAATGCAAAAAGCACATTCTTCTTCGCAT
TTAATCCCGCTACGATACCAGCTAATATTTTGCAACAATT
TTGAGAAAACCTTGGAAGAAAAACAAAAGAAAAAAAGAGA
CTTTTTTTGCTAAGATTCTGTATTTTACAAAGTACTTCGG
ATGTTTTCTACAATACTTTTTTGGCGATGAGTTTCGGGGG
CTGTTCGTTGGACCCTTTTCACGTTTCACCTTCTGTGGCA
TTTGCTCGGTCATTTATTATTTTTTTGTCTGGTTTGGATT
TTTGCATATTATGTCTGTATTATTTCCTCTTGAGAAGTAT
TTATTTTAAGGCGCCATAATCTGAGCTTGACAGGAAAATG
GTGCAGATGTTTTTATATGTTAATTTGATGATTGCTTGTC
AAATATCACTTGAAATAAAATAATGTCTACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations