ZFIN ID: ZDB-TSCRIPT-110325-1755
Transcript Name: acbd4-203
Previous Names: acbd4-001, dkey-110p6.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050926 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050926|OTTDARG00000032796|ZDB-GENE-040426-2074 acbd4|OTTDARP00000039996 DKEY-110P6.1-001 LG_ CT583704.20 Danio rerio protein_coding KNOWN, 1614 bp
GGATCGGTCGCTATAACGTTAACGTTACTGTTTTTATTTT
AGTTTGTCCAATGGCAGCAAAAGTACCGTTACAGTGCAGG
TTGTCCAGTTAATTAACGTGGTGTTGGAAAGACTACATGC
GGCATGCCAGCTCTTACAATGTCAGAGATCGAGGACTGCC
AAAGACGCTTTCAGGCTGCTGTCGACGTCATTCAAAGTCT
ACCTAAAAATGGTACCTACAAACCATCTTATGAAGTAATG
CTGCGGTTTTATGGCCTGTTCAAACAGGCAGTCTGTGGCC
CATGTACACTGTCACGCCCTGGATTTTGGGACCCTGTAGG
ACGTTACAAATGGGAAGCTTGGAGTAATCTGGGAGAAATG
AGTCGAGAGACGGCCATGGCTGCTTATGTGGATGAAATGA
AAAAAGTTGCACAAGATGTCATTGACACCATGCAAATCAA
TGAAAAGAATGCATCCTATTTCCACTATTTTGAACCTCTT
TACCATGTCATTCATGATATGCCCAGACCTCCAGAGGCAC
TTTTTTCTCTTAGTTCAGATGTTAATGTGAAAGAACCAAC
TGGTGATGTGTTTAAACATAATGTGGATAGTGCAACTCAA
GAACCAAGACTTCAACAGGATACAGAAACTTCCCTTAACA
GTGAACTTCAACCTCAGAGCACAGAGCAACGTATGTCAGA
GTGTCAGGGGCCGATTAGTGACACAGAGAGTGAAGTCTTC
TGTGACTCGTTGGAACAGATGGATAATATAAAGCTGACTG
CAGTACCAGATGGTAATAGTCCTTTCCAGAATGGTCGTAC
ATGCATCGAGATCTCTGGTATCCAGGAGAGTCATTACAGT
GCTCCATCACAGTTGGTTCAGATAGGAGTTGGACATGGTG
AGGGGGCAGAAGACAGACATGATCCTCCTATGAGGATGAC
GACCGCAGGAAGAGAATGGTTGCAGCAGAACTGGAGGGAC
TCCCCAGGTTTCATGGCTCACCACAGTGCTGGACGGCTAT
CAGCAGCTGGCTCAGGGCAAGGGGACAGAGACAATTCTAA
AAGTGGGTCTGGCCGGTTACAACAGCAGATTTTTCTAGCC
CTACGGAAACTCCGAGAGGACATGCAAAGTGTCATGGAAC
GACTAGATGTGGTTGAAAGTCTTGCAACTGCAAATGCTCA
GAATTCACATTGGATATCACATTTACAACGGACAGCTGGA
GAGTCTGAGGAGAAATGGTGGCCATTTGAAATCTCTGGAC
GCACATTGATGCTGTTGTTGGTGTGGCCTTTTGTGACACA
GTGGCTGAGTTTTCTCCTGAGATGGAAGAAGAGACAAATT
CATGGGTGCATATGAATTTAATAAATAGTCAAGCTACAAG
GATCACATATTTAATTGCCACTTCTCAGTCTCAGGTAAAA
GAAGAAATGTTCTAAAATCCTATGTTCGAAATTAGATCAC
TTAATTTTTTATGAACAAGTTGATGAACCAAGTTTAGGTC
CTAGCATTGATTGTGAATATTTCAACGTGTTCCATTTATT
TTTGGATAAAAATGGTTGTTTGTAATCATTTGTCTAAAAA
ATGTATGATATCCATACTATTGTGTTTTCAATATAAGTTT
ACTGTAAATTTTAA

acbd4 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript acbd4-202 (1)    Ensembl 718
mRNA acbd4-203 1614
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acbd4-203 Contained in:
[BAC] DKEY-110P6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050926 (1),  Ensembl_Trans:ENSDART00000150134 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC068326 (1) 1745 nt
CITATIONS (2)