ZFIN ID: ZDB-TSCRIPT-100915-1164
Transcript Name: acbd4-202
Previous Names: acbd4-002, dkey-110p6.1-002, zgc:85611-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045904 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045904|OTTDARG00000032796|ZDB-GENE-040426-2074 acbd4|OTTDARP00000036219 DKEY-110P6.1-002 LG_ CT583704.20 Danio rerio protein_coding KNOWN, 718 bp
AGCGCGGCTGGCTTGACTGTGTTTTTCCGAACCGCGGCTG
GCTTGACCGCAGTGGATCGGTCGCTATAACGTTAACGTTA
CTGTTTTTATTTTAGTTTGTCCAATGGCAGCAAAAGTACC
GTTACAGTGCAGGTTGTCCAGTTAATTAACGTGGTGTTGG
AAAGACTACATGCGGCATGCCAGCTCTTACAATGTCAGAG
ATCGAGGACTGCCAAAGACGCTTTCAGGCTGCTGTCGACG
TCATTCAAAGTCTACCTAAAAATGGCAGTCTGTGGCCCAT
GTACACTGTCACGCCCTGGATTTTGGGACCCTGTAGGACG
TTACAAATGGGAAGCTTGGAGTAATCTGGGAGAAATGAGT
CGAGAGACGGCCATGGCTGCTTATGTGGATGAAATGAAAA
AAGTTGCACAAGATGTCATTGACACCATGCAAATCAATGA
AAAGAATGCATCCTATTTCCACTATTTTGAACCTCTTTAC
CATGTCATTCATGATATGCCCAGACCTCCAGAGGCACTTT
TTTCTCTTAGTTCAGATGTTAATGTGAAAGAACCAACTGG
TGATGTGTTTAAACATAATGTGGATAGTGCAACTCAAGAA
CCAAGACTTCAACAGGATACAGAAACTTCCCTTAACAGTG
AACTTCAACCTCAGAGCACAGAGCAACGTATGTCAGAGTG
TCAGGGGCCGATTAGTGACACAGAGAGTGAAGTCTTCT

acbd4 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript acbd4-202 718
mRNA acbd4-203 (1)    Ensembl 1614
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acbd4-202 Contained in:
[BAC] DKEY-110P6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000045904 (1),  Ensembl_Trans:ENSDART00000138325 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EL651432 (1) 740 nt
CITATIONS (2)