Transcript

myo5ab-202

ID
ZDB-TSCRIPT-110325-1736
Name
myo5ab-202
Previous Names
  • myo5ab-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050849 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050849|OTTDARG00000035701|ZDB-GENE-050411-72 myo5ab|OTTDARP00000039927 myo5ab-001 LG_ BX088562.12 Danio rerio protein_coding NOVEL, 3582 bp
TTGGCCCGAGTCTGGATCCCAGACCCTGCAGAGGTGTGGA
GATCAGCAGAGCTCAGCAGAGACTACAGACCTGGAGATCC
TGTCCTGCATCTACTGCTGGAGGATGAGACGGAGTTGGAG
TATAAGTTAGACCTGAAGAGTGGCGTTCTTCCTCCTCTTC
GTAACCCAGATATCCTGGTGGGTGAGAATGACCTCACCGC
TCTCAGTTACCTTCATGAACCTGCGGTGCTGCACAACCTG
CGGGTCCGCTTCACAGACTCCAAGCTCATCTACACATACT
GCGGGATCATCCTGGTTGCCATCAATCCATACGAAAGCCT
GCCGATCTATGGCTCTGACATCATCAATGCCTACAGTGGG
CAGAATATGGGTGATATGGACCCTCATATCTTTGCCGTGT
CAGAGGAGGCCTATAAACAGATGGCCAGAGATGAGAAGAA
TCAGTCCATCATTGTGAGTGGAGAATCGGGGGCAGGAAAG
ACCGTTTCTGCCAAATATGCCATGCGTTACTTCGCCACGG
TCAGCGAATCATCTGATGATGCCAGCGTGGAGGAAAAAGT
CCTTGCATCCAATCCCATTATGGAGGCTTTTGGAAATGCC
AAGACCACCAGAAATGACAACAGCAGCCGCTTTGGGAAGT
ACATTGAGATCGGGTTTGACAGGAAACATCACATCATTGG
AGCAAACATGAGGACGTACCTTCTGGAGAAATCTAGAGTT
GTTTTCCAGGCAAGTGAGGAGAGAAACTACCACATCTTCT
ATCAGCTCTGTGCCTGCGCTCATTTACCTGAATTTAAACC
TCTAAAGTTAGGTAGCGCTGATGATTTTCCTTACACTAAC
CAAGGCGGAAGTCCAGTCATCGTGGGAGTGAATGACCTGA
AGGAGATGCAGGCCACAAGGAAAGCCTTTTCACTGCTGGG
AATTACCGAGGCACACCAAATGGGTTTATTCCAAATCCTG
TCAGCCATTCTTCATCTGGGGAATGTGGAAGTGAAAGAGA
GAGGATCATCCAGCTGTAGCATCTCTGTAAGCTATCATAA
AAATTCAAGAATGAATAATTTCTACTATACTGATTTCACA
ATACCATTTCATCACACCCAGGATGAAAACGGACACCTAG
CCATGTTTTGTGACCTGACTGAAGTGTCAAATGAATCCAT
GGCTCACTGGTTGTGTCATAAAAAGCTGAAAACGGCCACG
GAAACCCTTAATAAACCTGTGACCCGACTGGAAGCTGTGA
ACGGTCGGGACGCTCTTGCAAAGCACATTTACGCCAAGCT
CTTCTCGTGGATCGTCAGCCAGGTCAACAAGGCTTTGAGC
ACTTCTTCTAAACCGCACTCGTTCATCGGTGTCCTAGACA
TCTATGGGTTCGAGACGTTCGAGTTGAACAGTTTCGAGCA
GTTCTGCATCAATTACGCCAACGAAAAGCTCCAGCAGCAG
TTTAACATGCATGTGTTCAAACTAGAGCAGGAGGAGTACA
TGAAGGAGCAGATACCATGGACGCTCATCGACTTCTACGA
CAACCAGCCCTGCATCAACCTGATCGAAGCCAAGATGGGC
TTGCTGGATCTTTTAGATGAAGAATGCACTATGCCAAAAG
GTTCAGATGACTCGTGGGCACAAAAGCTGTACAACACTCA
CCTAAAGAAAAGCTCTCACTTTGAGAAACCTCGCATGTCC
AACAAAGCCTTCATCATATTACACTTTGCAGATAAGGTTG
AATACCAGTGTGATGGATTTCTGGAGAAAAATAAAGACAC
TGTCAACGAAGAACAAATTAATGTGCTGAAGGCTAGCAAG
TTCAGCTTGCTGCTCGAGCTCTTCCAGGATGAAGAATCTC
CTGCAGCTCCGAACACCACCGCTTCATCTGGCCGTGCAAA
GTTTGGACGCTCTACGCAGTCCTTTAGGGAACACAAGAAA
TCAGTTGGACTGCAGTTTCGTAACTCTCTGCACCTGCTGA
TGGAGACGCTGAACGCCACCACCCCTCACTATGTGCGCTG
CATCAAGCCCAATGACGTTAAAGCCCCCTTCATGATGGAC
CCCCATCGGGCTGTTCAGCAGCTCAGAGCATGTGGAGTCC
TGGAGACCATTCGCATCTCTGCCGCAGGCTTCCCTTCCAG
GTGGACTTATCAAGAGTTCTTCAGCCGCTATCAAGTTTTA
ATGACAAAGAAAGAAATTCTCTTAGACCGGAAGCTGACCT
GCCAAAGTGTCCTAGAACGGCTTGTACAGAACAAAGATAA
ATACCAGTTTGGAAAGACGAAGATCTTCTTTCGGGCTGGT
CAGGTGGCTTACTTGGAGAAGCTGAGGGCTGATAAACTGC
GTACGGCCTGCATCCACATCCAAAAAACCATCCGCTGCTG
GCTCGCCCGAATGAAATACCTACGCATTCGACAAGCGGCC
ATAACATTGCAGAAATACACTAGAGGACACCAGGCTCGAT
GCTTGTGTAAGACTCTGAGGAGGACACGGGCCACCGTCGT
CTTCCAGAAGAACACGCGCATGTGGGCTGCAAGACGACAG
TACCTGAGGCAGAAAACGGCAGCGGTGCTCATTCAGAGGA
TACTGCGTGGATATACGGCTAGACTGGAGTACAAGCGGTT
GGTGTGTGAGCACAAGGCTCTACTGATCCAGCGGTGGGTG
CGTGGCTTCCTGGCCCGCTGGCGTTATCGGCGCATCAAGC
GGGCTGTGGTGTATCTTCAGTGTTGCGTGCGCAGGATGCT
GGCCCGCAGAGAGCTCAAGAAACTCAAGATTGAAGCCAGA
TCGGTCGAACACTACAAGAAGCTCAATTATGGCATGGAAA
ACAAGATCATGCAGCTGCAGAGGAAACTAGATGAGCAGCA
CAAAGAGAACCGAGAGCTTTCAGAGCAAATAGGTGCAATA
GAGAGCCACAGTGTCGTTGAGTTGGAGAAGTTGCATGTGC
AGCTCAAAACGCTTCAGGAGGCGGAAGAAGAGGCCCGTCA
TCGGGAAGACCTGGTGACATCATTACAGGAGGAGCTGGAT
TTGGTTCGCCGGGAGCTGGAGAAGAACAAAGAGATGGTCG
TGGAGCTGAATGAAAAGAACACAATGCTGAAGAGTGAGAA
AGAAGAGATGAACAGACTGATCCAGGAACAGGAGCAGCAG
ATAAGAGAAAAGTCAGAGGCGACCAACGAGGATGTGACTG
AGAACCTGCAAACGCAGTTGAATGAGGAACGCTTTCGTTA
CCAGAACCTGCTCACTGAACATCTGAAACTGGAGGAGCGC
TACGCTGATCTGAAATCAGAAAAGGAGGTGGCTGAGATTT
CCACAGCTGGAGATAGCAGAGCAGACTCTGGATACAGCAG
CAGCCAATCAGAGAGCATCCATAGCTCTATGCTCACAGGG
TCAGAGGTCAGCTCGTTGGAAAAAGAGGATGCTGTGCAGG
TGGCAGCTGATGTTTCCCTGCTGCTGAAACTGCAGAGGAG
AGTGGCTGAGCTGGAGAAGGAGAACATGGACATGCAAAGT
GAGATGGACACCAAAGAAGAGCAGCTGATATTGGAGAAAG
CTAAAGAGTTGGAAGATTGTCGAAAAACATTAGGGGCTGA
AAGAGACTACGAGGCTCTGAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations