Transcript

sost-201

ID
ZDB-TSCRIPT-110325-1728
Name
sost-201
Previous Names
  • sost-001
  • dkeyp-44b3.1-001
  • si:dkeyp-44b3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000050823 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050823|OTTDARG00000035684|ZDB-GENE-110411-139 sost|OTTDARP00000039907 DKEYP-44B3.1-001 LG_ CR932037.8 Danio rerio protein_coding NOVEL, 2238 bp
GTGGTAGTTTAAAAAGGCAAGCCTCTCCCGAAGAGAAGAA
AACTGGTCGAAGTTTGCCCGCTGAACGGCTCGTTCTCGGT
TGTATTATGCAGGTGTCTCTGGCGCTCGTGCACTGCGGCG
CGCGGCTGTTGCTGCTGCTGCTGCTTCAGGGATGTTTCAC
AGCTGCGCACGGATGGAGGCCTTTAAAAAACGATGCTACA
GAAATTATACCAGAATACGCGGAGGACACGCACAAACCCG
AGGAGCAGATACAACTGTCTGACAATAACACAATGAATCG
GGCGAAGAACGGTGGAAGGCGGTCGTCAGCAAACACACGG
ACTTATGGAGCCTCAGAACTCAGCTGTCGGGAGTTGCGTT
CGACCCGATATGTGACCGATGGATCTTGCCGCAGTGTCAA
ACCCGTGAAGGAACTTGTGTGTTCTGGTCAGTGCCTTCCA
GCTCACCTGATGCCAAACTCAATTCTACGGGGGAAATGGT
GGAGAAGCAGCTCCTCCGATTACCGTTGCATCCCTGCTCA
CTCCCGCACCCAGCGGATACAGCTCCAGTGTCCAAACGGA
CCAAACCGGACATACAAAATACGAGTTGTCACATCTTGCA
AGTGCAAACACTACACTCGACAACACAACCAATCGGATGT
CAAAGAGTCGTCCAAGAAACCACGGCGCAATAAGAAGCAC
CGCAGCAAAGTGCCGTCCATCAACAGCAATTCATACTGAG
GGGAAAAGATGCAGAACTGATACAGAAAACACTCTCTTGC
ACACATACAAAAAAAAAGAAAGTACACCAATACATATGCA
CACATATTACAGAAACTGCAATCCTCATCTACAAGGGAAG
GAATAAACGCATTAGCATTTACCAAGCTTGTTGGCATGCT
AACAAGTTTCCAATGTATTTCAGATGTCTCGCTGTTTGTA
TGTGCTCTTGAGCCTAAATCGTCCCAGTTTGATCACAATA
TGCCAGCGGACTGAGTGAAAAGACGTCCGCTGTTATGCGA
GATTAGATCAGGCAATGTGATTTTTTTGAGGGAGGAGAAA
TATTCCTGCTCAAGCGGTTCATTTCAAGTTCACCGAAGTT
CATTGAAAGGCTAACTTACGGGCAAGCATACTGAGTGCTC
CACCAGTCCAGCAAGTGCTCATGTGAATGTTTGTGCACCA
GATTTGTCCTCTTTTGGGATTCGGAGCAGTGTATGATTTG
AGCGCTCAGCCGCGTCTGGCCCAAAAGACACGCTGCTGCT
GACAGACCACTGAAGCCCAGAATTCTTAACCTTGGTCACT
TTTACCAGGTCCTTTTTGACAGGCTGGGGAGTCCATGTGA
GTGTCTGCAAATTCACATTTCCACAAGAAACTGATCGACA
CTGGCAGCTAGAGCCGCCTTACGGAGAGTTCGGAAAGTTG
TGTCAGCCCTCCACGGTCCAAGTCCCTGGAGGTCGAGAAC
AGCAAACGGTATTCCTGTGACTTGTCCTAATTACCAAATA
GTTCCATTCCTGTGTTTAGGATTTGAGTCATAAAAAGCCA
TTTCCTCTAGACATGGTCAGTTCCTGTTTGTTCGAACACC
CGAAAAAGAGGCCCACATGTGTGCACGAATCTGCAGCAAT
TCCTCGCGGGCAAATAACCTTTACGCACCCTCCTTCAATG
GAAACCATTTGGAGATATTCAGCTATCTGCAATCGCTAGC
AGGTTACCTACATCCATTACTGAAGTCTTCAGCAGAGATG
TCATCCTTCCTGTCTCCACACATGACCGGAAAAGAACAAA
CAAATAAGTGAACCAATCTCTGAAATCGTGGGCTGGATGT
TGATTCTACACAGGATACAGAGATCAGAGAAGGCCAATTG
TTCAACATTTTTTCTGCCCACCTCGATGATATTTGCTCAT
TTTTTCAATTGTGTGTTTGAAATAGCAACTGGAAGGGATT
TCTTATAATGTAAGCAGACTTGTCGTGAATAGTAACTTGT
ACATAGTATACCTGTGTGGTATACCTGTGTAGTTTACCTG
TGTGGTCTGTGTGGTGAGCGGTATCCTCCTTCAACCAATG
GATCCTCTTTCAGACCAAAAGACTGTTACAAAGAATGAAC
TGTGTATTTATTTTTGTATTTTTATCATTTAAATTATTTA
TGCAATCTGTTTTTTTTTTGTAGAAAATAATAGCCATTAT
TGTACTATATGTAATTATAGTGAATTTCATACCGAAAAAA
AAGAGTACATGAATAAAGTTAAGCAACCTATATATGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations