Transcript

cox10-201

ID
ZDB-TSCRIPT-110325-1712
Name
cox10-201
Previous Names
  • cox10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050766 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050766|OTTDARG00000035651|ZDB-GENE-041111-239 cox10|OTTDARP00000039860 cox10-001 LG_none CR749163.11,CR847567.6 Danio rerio protein_coding KNOWN, 2240 bp
GCGTGGCTCGTGCACTTCTCCTGCGGACATACGTCACAGG
AAACACACAGTCAAGATGGCGCGCTGCTGCGTGTGAAGGG
GACTCAGCGGCTGCCGGTCACTTTCTGGAAGAACATGTAC
AGAACGTCATGTAGTAAACTGACGGGAGCCTGGAAATGCC
TTCAGCTTGATGGCTTGGTTGGTTCCAGTGTGCAACAGAA
GCTGTTTGCAAATGCTTCGAGGAGTCATATGAGTGCCAGA
AGTCTGATTCAGCTCTGCAAGAAAAATCAGGCTGAATGGA
TCACGTTTCAGCATCTCTGCTTTCTGAAGAGACAGTATGT
GAAGAGCAGCAGCGGTCTGTGCCAGAGAGCAAGACCCAGG
CAGGAGCCTGTTTCTGCTGTGCTGGATGATAGAGATGATT
CGATGGTACGACAGGTTCAGCAAATCCCAGCCTTAAAGCC
TGAGCCTGGTACTGAGGTGTCGACATGTGCCACGGAAAGC
AACCAGGTCGAACCAGAGGCAGATAGAGTAGCTCGCCTGG
AGGCCCGCCAGTGGAAAGAGATGAGGGTTCAATACAGTGA
TTTACCAGGGATTTACGCACGGCTCTCCAAACTGAAATTA
ACAGCCCTTGTGGTTACTACAGCAGCTGCCGGCTTCGCCA
TGGCTCCAGTGCCCTTTGACCCTGTCGGGTTTTTGATGGC
TTCTTTGGGAACAGGTCTTTCGTCCTGTACGGCCAACTCC
ATCAATCAGTACTTTGAGGTTCCCTTTGACTCCAACATGA
ATCGTACCAAAAACAGACCCCTGGTCAGAGGACAGATCAG
CCCTCTGCATGCCGTGTCTTTCGCTCTGGCCTGTGGGATC
CCAGGTGTGACCCTGTTGACCCTGGGTGTAAATCCTCTGA
CTGGCTTCCTGGGCGCCCTGAACATCTTCCTGTACACGTG
CTGCTACACTCCTCTGAAGCGCCTCAGCATCGCCAACACC
TGGGTGGGTGCAGTGGTGGGTGCTATCCCACCTGTGATGG
GCTGGACAGCAGCCACCGGCTCTCTCGATCCAGGAGCACT
TTTACTGGGAGCCTTCCTGTTCTCCTGGCAGTTTCCTCAC
TTTAATGCCTTGAGCTGGAATCTGAGAGAGGACTATTCGC
GCGGCGGGTACCGAATGATGTCCGTCACCCATCCTGGCCT
TTGTAAGCGCGTGGCCCTGCGCCACAGCGTGGGTCTGATT
TTCCTCTCAGCTTTGGGCCCCGTGCTGGACGTCACCACCT
GGACGTTCCCTTTAGTCTCCTTGCCCATTAACCTTTACAT
CAGCTACCTGGCGTTTAGGTTTTACAGGCACGGCGACCGG
CAGAACTCACGCAAGCTGTTTTTCTGTAGTCTTTGGCATC
TGCCCATGCTTTTGCTGCTGGCTCTCACCTGTAAAAAGAG
CCGCGTGGCGCAGGACGAGGCCGCTGTCACTTCCAGCTCA
GCTTCTTTGGCTCTGTAGAGCAACATCCTTCCATACTGGC
TAGATAATTGCTGCCGTTGGCCACTAAATAATTATTTTGG
CACAAAAAACACACCAAAAGTTAGAAAGAAATCAACCTCT
TTCCATTATAAAAGTTTCCATCAGGGAAAAAAAAAAGTGC
TAAAAGTCCCTGAATTCACTCAGGTAATGTGTACACAAAT
CAACGTCTGTGTAAATACATGATATATTTATTTAACGCAG
CCCCATCCTGTTTGACTATGAGCTTGTAGACTCCTGTGTC
TATGTAAAAAGCATAACAGAAATTGAAGGTCTACAAGAGC
GCATTTTGCATTCAAATCGCCGTTACTGTTGATGTTTTGG
TTAAGTGCAGAAAACGGTTTGTGCTAATGCATTTCAAAGT
TTGTCCTCTTTTAATTACTTGCTAAGTGACGTTTTCACTT
TCTAATATTTCATTGCAGAAATAAATGGCTTTGTAACAAA
TCTGTCAGCCCAGAAGGCTTTATCATTGTATGAAACTCCG
TCCCTCTGAGTTTGAGTTGAGATGTTTAAAGGCTGATATT
TTGGAGAGCTTTCGGATGTCAGATTCATTGAGATTATTTG
AAAATGAGTCAAATAAACCCATTTGAATTCCCCAGAACTG
AATTAATGATGTTAATTAATTGAATAAGATTGCTGAGTAT
TTGTTACTTCGTTGGCTTGCTCCAAATGGGGGTTTTACAC
AGATCTGACCTCACTGTTCCAATGACTTGTGTAAGACACA
ATAAAAGAAAGTTCATGTTAATAAAATATGTTACGATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations