ZFIN ID: ZDB-TSCRIPT-110325-1711
Transcript Name: pax2b-202
Previous Name: pax2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050762 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050762|OTTDARG00000035648|ZDB-GENE-001030-4 pax2b|OTTDARP00000039856 pax2b-001 LG_none CU595866.6,CU565473.8 Danio rerio protein_coding KNOWN, 1467 bp
CGGGCCGTGCGCGCACGCAAACGCATCGTGTTGTTATTAT
TGAGGAAAAAAAGGTGCGCACAGGAAACCCGCAGTCTCCA
ATGCTTCAGCTATCTGTCACTACGCGCAGATCCAAGAGAA
ACGGCACCTGCTAACCGAGACCACCAGGATATAACACGCA
AATGGACGGGACGTGCGCTGGAAAATGAGTTGTGGGGAAA
ACATGCATGCTGAAAACATTTAAGCGTCCTTTGCGTTGAG
AGCACTCTGTTTTGACCCAGAACGCACGGTCATGCCTGAC
ACCTGACAAATCCTGCGTGCATTTGCAACTTTCCGAAGTT
TCCCCCGATATCCTCGGCTGGATTCACCTTACGTCCTTCT
TCGATTCTTTCAGTTGTTCTGTGTTGTAAGAAAGACGAGA
CGGCGACTTCAGTTGATTATCTGTCTTTTCTCGGTTATCC
GATGGATATTCACTGTAAGGCAGACCCCTTCTCCGCCATG
CACCGGCACGGGGGAGTGAACCAGCTGGGCGGGGTGTTCG
TCAACGGGAGGCCTTTACCTGACGTCGTGCGCCAGAGAAT
CGTGGAGCTCGCGCATCAGGGGGTCCGACCCTGCGACATA
TCCCGACAGCTGAGGGTCAGTCACGGCTGCGTCAGCAAGA
TCCTGGGCAGATACTACGAGACTGGCAGCATAAAACCTGG
AGTCATCGGAGGATCCAAGCCTAAAGTGGCCACGCCGAAA
GTGGTGGATAAAATAGCGGACTACAAAAGACAAAATCCCA
CCATGTTCGCCTGGGAGATCCGGGACAGGCTGCTGGCGGA
GGGCATCTGTGATAACGACACCGTCCCCAGTGTCTCCTCC
ATAAACAGGATCATCCGGACCAAGGTTCAGCAACCGTTTC
ACCCTTCACCAGACGGGACGTCCCTCTCCACCCCAGGACA
CACTATAATTCCCAGTACAGCGTCTCCTCCAGTCTCCAGC
TCCTCCAATGACCCCGTGGGCTCCTATTCAATCAACGGCA
TTCTGGGAATCCCTCGGTCTAACGGAGAAAAGAGGAAACG
AGATGCCGACGGGTCGGAGGGTTCTGCGCAGAGCAGTGAT
TCTCAGGGCAGTGTGGAGAGTCTGAGGAAACACCTGCGGG
CCGATGCCTTCACACAGCAGCAGCTGGAGGCCCTGGACCG
AGTGTTCGAGAGACCCGTCTTTCCTGACGTCTTCCCTACA
TCTGAACACATCAAACCAGAGCAGGCGAGTGAATACAGTC
TCCCTGCATTAAACACAGGCCTGGATGAAGTCAAACCCAG
TTTATCGTCCAGCGCGGCCTCTGACCTCGGCGCCAGTGTG
TCACAGAGCTACCCTGTAGGGCGAGATATGGCCAACACAA
CCTTACCTGGATATCCACCTCACGTCCCTCCGACAGGGCA
GGGCAGCTATGCCACATCCACACTGGCTGGAATGGTTCCT
GGTGAGTATCTGCAAATAAAATGTACA

pax2b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pax2b-202 1467
pax2b-203 (1) 735
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pax2b-202 Contained in:
OTHER pax2b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050762 (1)
  • Ensembl_Trans:ENSDART00000149044 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF072547 (1) 2652bp
    CITATIONS (2)