header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1624
Transcript Name: lmbr1-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050327 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050327|OTTDARG00000035375|ZDB-GENE-090128-4 lmbr1|OTTDARP00000039502 lmbr1-001 LG_none BX247878.5,CR352339.15 Danio rerio protein_coding KNOWN, 4893 bp
TTTGGCGCTGAGCGCAACCGCTGTCAGTCAGTCGAGCTCT
TCCAAAGGGCGGTTTATTTATCTGATAAAGTCGCTTTCTC
TCGCAGTGAATGGACTGGCCACCAAAATGCGTTGCTAATG
AATGTGTTTCTGCAATATGAAGAATGGAAGACGATGTGAC
GATCAGAGAGCAGAATTTCCACAGCCAAGTGCGCGAGTAC
ATCGTCTGCTTCCTCTTGTTTGCAGTACTGTACATTGTGT
CGTACTGCATCATCTCACAGTACAAGAGGAAAAGTGATGA
CCAGGAAGATGAGGATGCCATTGTCAACAGAATATCTATG
TACCTGTGTACATTTACATTGGCGGTGTCTGGAGGTGCTG
TCCTCCTTTTACCATTCTCTATAATCAGCAATGAGATCCT
GCTTTCTCTTCCAAAAAACTACTATATACAATGGCTCAAC
GGATCTCTCATACATGGCCTGTGGAACCTGGTCTCCCTCT
TCTCAAATCTCAGTCTTTTTGTGCTGATGCCTTTTGCCTA
CTTCTTCCTGGAGTCCGAAGGCTTTGCTGGTTCCAAAAAG
GGCATAAAGGCTCGAGTGCTAGAGACGTTTGTCATGCTCT
TTCTGCTGGGTCTCCTCATCCTGGGCATCGTATGGGTGGC
GTCTGCTCTCATTGACAATGATGCTGCCAGCATGGAGTCA
CTTTACGATTTATGGGAGTTTTATCTGCCGTACCTCTACT
CCTGCATCTCTCTGATGGGTGGCCTCTTGCTGCTCATGTG
TACTCCAGTGGGACTGTCACGCATGTTCACAGTGATGGGC
CAGTTACTAGTCAAACCCACAATTTTAGAGGATCTGGATG
AGCAGATTTATTGCATACAGCTGCAGGAAGAGGCCTTGGA
GCGAAGACTCAATGGTACGACGTCAAACTCCTATCTCCAT
GGAAACTCTCAGCACCATCTCCACAAAGAGCTGGACAGCG
TTCGCAATCAGAGACACAAACTCGAAAGGAGAAAGAAGGC
CTCAGCCTGGGAAAAGAACCTCCTTTACCCCATAGTGATG
CTGATCCTGCTTGCTGGAACAACGATTTCTGTTCTCCTGG
TTGCCCTGAACATTGTGTACCTGCTTGTTGATGAGACAGC
CATGCCAAAGGGTTCAACGGAGAGAGACATTGGCAATGCT
TCTTTATCCACATTTGGAGTTGCCCAGGCGGTTGTTGAAA
TCATCCTCATGTTTTATCTGCTTGTCTCCTCTGTGGTTGG
TTTCTACAGTCTTCGTATCTTTCAGGAACTCACTCCCAGA
AAGGACGACACCAACATGACAACGATCATTGGTTGCTGTG
TTTCCATACTAGTGCTGAGCTCAGCTCTGCCTGTGATGTC
CCGAACACTCGGAATAACAAGGTTTGATCTCCTGGGTGAT
TTTGGACGATTTAACTGGCTTGGGAATTTTTACATCGTAC
TTTCGTACAATCTTCTGTTTGCTGTGGTGACCACATTGTG
TCTGGTCCGAAAATTCACATCTGCCGTGCGAGAAGAACTT
CTCAAAGCCCTCGGTCTGGATAAATTGAATCTGTCAACCA
GCACGACGGATGCAGAGTCAGGGAAACATGTCGTCAACGG
ACATCAGAAAACTTTGTGAGGGGAAACGAATCATCCAGAT
ATTCTGAAGCAAACATGTGTATGTGAATACAGTTGGCTTT
TTCATTTTGAAATCCAGTCATGAAGCATTAAATATTAAAT
GGACAATAATTAGAGAAAGAAGTGTTTAGACTCGCTTAGA
GTCGCCTGATGTGAATATACCCATCTCCTCATCCGAGCAG
TCATATCTCTACTGTATATACCACTGTCCATCATTCATCA
CTTGACTTTAGTTAGCTTGGAAATACTTTCACATTATGAG
GTAAGACAATGTTTTTTCTTACTGACCTGCACACCTAAAT
GCCTCTAGACTGCACCCTTCAATGGGAACTACTGGTATCA
TTATTCTTCACAATAAGCATTATCCTATATAATTTTCTCT
AGTTTGGGAAATATTAAGCTGTTGGCCAAGCTGATCATTT
TATGTGCAATGAAGTATGCAGTAGTCTCAATTAGGGCATA
TAATCTTTCTCCAAAATATTTTTGTTGACATTTTGTGCCC
TCTTTAATCAGTATTTACTCGTTATGTGAAACACATTTAG
GCCATAAGGGCCTAAAATAATACATAAAAAAAACTGGAGA
CATCTTTAATAAATGTGATGTCAAAAACCAAACCAAAATT
GTAATCTAGAAAAGGGATTTTTTGCAGTGAAACGTGCTGT
ATGTAAACTCAAGTTAAGTTACAAATGTTCAATTGCCAAA
TTGACCAAATGAGACTCAAAACAAAACATCTTCAAGATAA
AATGACCTGTAAATATTTCAAATATTCCGATCCATAGCCA
TCGAATTTCATGCTTGAATTTCCAAGTGTAAAATACGTTT
TATATCTGGAAACTTGTCTGCCATTGAATATGTTTACATT
GTTACAATGAAGAGAATTCTTATTTCGAAGTTGGTCAGTT
ACAAAAACGAGGAAGTATTATGATTTGATTCTCCTCATGC
TTTACTGTGACAGTTCAGGTTTGTTGGATGTGACAGAATT
AAGTAATGGGACTTGACATGGAAACTCCCCAAACATGTGC
CTTACTCACAATATTGGCATATTCTGGGCAGCATTGGGAT
GTTATTAACCGTGGTGGCGCCTACCTGCCAAATGTCATGG
GTAGGCAAGGTTCAAATGCTTAATATGTTATTGTGTTTAC
TTGAATTGGTTATGGCAGATTGTCATTGTTGTTAATATCA
CCTCACATGTTTTAAACACATTTAATGGATTGTAGAGTTC
TGTCGTGAAATAGTTTAGTAAAGTCCACTTAATATTCGGG
AAAAGGTGAGGCACAATCCTGGGATAAGCTTCCTGTTCCT
GTTCTTAAATCTGCTGCTACTTCCTCCACAACCTTTTGAT
ACTATGCTACGTGTACTACACAAACCTGGTTTTTCCCCTC
AGTGGGAGAGCAGATAACCAGTAACGTACATCCTTAACCC
TTGGTTATTGCTGCAGAGCTTGTTTGCCTTATTTCAGCCT
TCAAATATCTAGTCTGTACCTCTAAGGAGATTACTATATC
CACAAACATAGATATTTGTATGTTTTCCACTCAAAGTCAT
GCTATTGAATTACTGGTGTACGCAGATCAGAGGCTAAATC
TGCTTTATGTAGGAACTTGTGTGTCGAGCCACATGGGTTC
CAGTTTACACCTATTAAAGCTGAATGTGAAGTCAGCTGTC
ATTACGCATGTAGAAAGCAGCATGACTCGTTATTAAACGG
GTCTCATTCGTCACTAGTAATGTCTCTTTTTACTTTTCAT
ACTTCCAAATATTACATTGTTTAATGTACAATATAGTTTC
CAAACATTCCCATCCTGAAGACAACTCCAACACCAAGAAA
AAGAAACTTAGAAAACCGTTTAGGTCATTCCTGACATTTC
TCTCTCTGAGTTTTAATGTAAAGCTATTTAGGATTCCTCC
GTTTGGTCTTTAACTACAGCAAGCCTCATGGTAATGTAAA
TGATGTATATACAATATATTTGCTCTTTTTATTTTTGTAG
GATGTAGATATGAAACAGGCTTTTGAGCCTCGTTCATACT
ATGTCGTTTTGTCGTCTCTCAGCATTTGTTTATTGTAAAA
CAACACAAAAACAAACAAAAAAAAATCACCTGTTGCCTTA
AATAGGCTTATTTTGGGGCTTTGTTCTCCTGTTGTCCGCT
ATTGAGGAGACGAGCTGTGCATGTGATGTGTGAGACGTGC
AAATGAGTGAAAGAGTGATTGTTAGTGCGTGTTCCTTTTT
ATTGACTGATTCACTGTGAATCCCTCGTGTGATTGTCTGT
GATATGGCAAACCAAAACGACAGGGCGCATCTTTTAGAAT
CAACTGGCCAAAGGCAACAGAAAATATCAGGGCACTGATT
TGGAATATTAATAGGATTCGCATGAGGGACGCTGAATTTA
AAGGTCATTTAAAAATTGACACCTCAGTGGGTTCTGTGGT
TCAATCCGATGTGTTATTTGCTGTTTTTATTGTCATGAGT
TTAACAAAGTCAAATGTAAAAGAGAAGTTCTTCCTGTTGA
TTTGCACAGAATATTTTGTATGAGAATGTTTGGGAAATAA
GTGTCATGTCAGTCATTTTGTCATTGAAGTAAACTTTTTT
GTTTTTAAATGTTGTTTTTTCTGTTTGTGTGTGTATAAGT
GTATCGAACTTGTAACGCCAGAAAATTTTGTGTCATTACC
TATTTATCAATACTGTCTGTGGACGAAATGGAAAGATGCT
AGTGTTTGGCTTTAATCAAATCGTTTTTTTTTTTGTTGTT
GTCGTTTTTTTTGAGGGATGTTGCAGGGCCAGGCTTCACA
CCTGGTTCTTCTTTATGCAGCACGGGGACTGGAGTGTCAG
TTGGTGTTTTGGGGTTACTCAAAATAGAGGCATTTGCGCT
GATGTACTAGAATTAACTGTGAAAGAAAAAGAAGCCTAGT
CATTCCACGTTCTGTTTTCTGCTTCAGGGGTTCATCTCTC
TTTGACTTGGTGTGCACGACACCAAGAAGAGCTGTTTTTA
GAAGATCTACAGAAATGTACTTTCAGTTCTTCTGTCTGTT
TATCGGTGACAAACTAAAGTTGTCTGTCCAGACACCAAAA
CAGTGTCTGTTCATCCGCTTCTCTTCTTCAGCTCTAAGAG
AAAGCTTAATTCTGTGTCCAGTGTGTTGTCTGTTTGATTC
TTCTACATGTGTGAATGTACTTTCAGAATGTTCTCTCTTC
CATTTGTAGTATACTTGCATATGTTTTGTGAAGAAAAACA
ATTCAGATTCTCTTTTGTTTATTTTGTAATTCACTTCAGT
TTACAATAAAGTT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmbr1-001 Contained in:

OTHER lmbr1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050327 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN837561 (1) 903bp
    GenBank:EB961725 (1) 545bp
    CITATIONS (1)