ZFIN ID: ZDB-TSCRIPT-110325-1621
Transcript Name: ace2-202
Previous Name: ace2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050314 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050314|OTTDARG00000035365|ZDB-GENE-041114-6 ace2|OTTDARP00000039491 ace2-001 LG_ CU652893.6 Danio rerio protein_coding KNOWN, 2870 bp
AGAATCGGTGGGACAAGGCTGTGGTCATGTGTGCTCGCTG
GCTCCTGCTTTTGGCCTTGGCCTCTGTGGCCTGCTGTCAG
ACTGTGGAGGACAGAGCAAGGGAATTCCTCAACAAATTTG
ATGAAGAGGCATCTGACATCATGTACCAGTACACCCTTGC
ATCCTGGGCCTACAACACAGATATCTCCCAGGAAAATGCA
GATAAAGAGGCAGAGGCATATGCAATCTGGAGCGAGTACT
ACAACAAGATGTCAGAAGAGTCTAATGCCTACCCCATAGA
CCAAATATCGGATCCAATCATTAAAATGCAGCTCCAGAAG
CTTCAAGATAAAGGATCTGGGGCCCTTTCACCTGACAAAG
CTAGTGAACTGAGAAATATCATGTCAGAGATGAGCACTAT
TTACAACACGGCGACTGTGTGCAAAATAGACGACCCCACC
GATTGTCAGACTTTGGAGCCAGGCCTAGAGAGTATCATGG
CAGAGAGCAGAGACTATGATGAGCGTCTGCATGTATGGGA
AGGCTGGAGAGTGGCCACAGGGATGAAGATGAGACCCTTG
TATGAAAAATACGTCGACCTGAAGAATGAAGCTGCCAAGC
TCAACAACTACGAAGACCATGGAGATTATTGGAGGGGAGA
TTATGAAACTATTGATGATCCCAAATACAGTTACTCCCGA
GACCAAGTTATAGAAGACGCCAGGCGCATTTACAAAGAGA
TCTTACCACTGTACAAAGAGCTTCATGCTTACGTGAGAGC
AAAACTGCAAGACGTCTATCCTGGTCACATTGGCTCTGAT
GCCTGTCTTCCAGCACATTTGCTTGGTGATATGTGGGGAC
GGTTTTGGACCAACTTGTATCCTCTCATGATCCCATATCC
AGACAGGCCTGATATTGATGTGAGCTCCGCAATGGTGGAG
CAGGGTTGGGATGAAATCCGTCTGTTTAAAGAGGCAGAAA
AATTCTTCATGTCTGTAAACATGCCTGCAATGTTTGACAA
CTTCTGGAACAACTCAATGTTTATTAAACCTGAAGAAAGA
GATGTGGTTTGCCATCCTACCGCATGGGATATGGGAAACA
GAAAGGACTTCAGAATCAAAATGTGCACTAAAGTGAACAT
GGATGATTTCTTAACTGTCCACCATGAGATGGGGCACAAC
CAGTACCAAATGGCTTACCGAAACCACCCATACCTGCTGA
GAGATGGTGCCAATGAGGGCTTCCATGAGGCTGTTGGAGA
GATCATGTCGCTTTCTGCTGCCACTCCGTCTCACCTGCAG
TCACTGGGGCTTCTGCCTTCCGACTTCAAACAGGATTATG
AGACAGATATTAACTTCCTGTTGAAGCAGGCTCTCACCAT
AGTGGGCACTCTGCCCTTCACCTACATGCTGGAGGAATGG
AGGTGGCAAGTCTTCAAAGCAAAAATCCCCAAAGATGAGT
GGATGCAGCAGTGGTGGCAGATGAAGAGAGAACTTGTTGG
AGTGGCCGAGGCTGTTCCCAGAGATGAGACGTACTGTGAC
CCTCCAGCACTTTTCCACGTTTCTGGAGATTACTCTTTCA
TTAGGTACTTCACTAGAACCATATATCAGTTCCAGTTTCA
AGAGGCATTATGTAAGGCAGCTGGCCACACCGGTCCCCTT
TACAAATGTGACATTACAAACTCAACCAAAGCTGGTGACA
AACTCAGGCATATGCTTGAGTTAGGCCGATCCATGTCTTG
GACTCGTGCTTTGGAAGAAGTTGCAGGAACCACAAAGATG
GACTCACAGCCACTGCTACATTACTTCAGTACTCTCATGG
AGTGGTTGAAGGAGGAAAACCAGAAGAACAACAGAGTTCC
TGGCTGGAACGTCAATGTTAACCCTGGTGTACTTACATCA
TCTTTTATAAATGATGCAGAAATTTCAGAAAATGCCTTCA
AAGTCAGAATAAGCCTTAAATCTGCCCTGGGAAATGAAGC
ATACACCTGGAACGCAAATGACATTTATCTCTTTAAGTCC
ACTATGGCCTTTGCCATGCGCCAGTACTACTTGAAAGAAA
AGAACACAGATGTAAATTTCACGCCAGAGAATATCCACAC
GTACAATGAAACCGCCAGAATATCCTTTAAATTTGCTGTG
ATGGATCCAACCAAAACAGGCACAGTTATTCCAAAGGCAG
AAGTAGAGAATGCTATCTGGCAGGAGAGAGATCGCATCAA
TGGTGCATTTCTACTAAGTGACGAAACTCTGGAATTTGTT
GGTCTGATGGCAACATTAGCACCACCAAAAGAGGAAAAAA
TCACAATTTGGCTGGTGGTGTTTGGGGTAGTAATGGGAGT
GACTGTCCTTGCGGGGATCTACCTCGTTACCACAGGGATA
TTAAATAGGAAGAAGAAAGCTAAGAAGGCTAAGGAGGCCT
CAGTTGAGAACCCATACGATGGATCAGATGATGGTGAAGT
GAACAAAGCCTTTGAGGAAGACATTGAACAAACAGGACTG
TAAACAAATATGCTTTCAGAAAAAAAAAATCAGAAAGGTT
CCACATCATTGCATGATTTTGTTTTTTAAAACAATGAACA
GACGTCTTTTTCGTGTGTCTTTACAAATATTTATTTGAAT
GCATGATATAGGAAAGATATATAGTATGAACACATAATAA
TAAGATACAATTACTGTAACTATGAAAATAGAAATTGCAA
GCTTATACATACGGTACCAATGTAAATAGGGGTTAATATT
GTAAAGCAGTTATATGTTTTTCTAAGAGGTTTGATTAAAT
ACTACAACAATATAACCAGTGTTTCCTACATTATAATTAA
AAGTAGCTCAATGTAATAGTGTGAAAGGAAACAGTGACAC
CTTCTAAATAAAATCCTAAATATGACTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ace2-202 Contained in:
OTHER ace2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050314 (1)
  • Ensembl_Trans:ENSDART00000126110 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC085667 (1) 2881bp
    GenBank:CD015482 (1) 636bp
    GenBank:EB877978 (1) 631bp
    CITATIONS (2)