ZFIN ID: ZDB-TSCRIPT-110325-1567
Transcript Name: crx-201
Previous Name: crx-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050095 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050095|OTTDARG00000035239|ZDB-GENE-010403-1 crx|OTTDARP00000039324 crx-001 LG_ BX927323.5 Danio rerio protein_coding KNOWN, 2381 bp
GATTAGCTGCTCGGTCTCTTATTGCTCATAGTGTCCCGCT
CCTGTCCGGTCTTACCCAAGGGACACGCGCCTTTACCAAC
GCCAAAACTCTTGACCAAGAGCCAGCAACTTTTGTGCATA
TAGACATTTATTTGTTCTTTAACTCACATTAAGGGTCTAT
TATTGGATATTTAGAGCGATAGTAATGGTAGATTGGTAGT
TAAACTTGGGCAAAAGTGTAAGCTTATTGAAGACAGCGAG
TAGCGCGCGCGCGAGCATCTACAGGTGTTTGAGGAGCACA
GACACGCGCCAGGCGCGAGCACAGACACGCGACCCCCGAC
CCGTAAAACAGCGTCGCAGAGAAAAAAGAGAGTGAGAGAG
GGGTGAGAGAGGGAGGGAGAGAGAGAGCAATAGAGAGAGT
GTGCGAGAGACGCGGCCGTCCCAAGAATGATGTCCTACAT
AAAGCAGCCCCATTATGCTGTGAACGGGTTAACACTGTCC
GCCTCAGGAATGGACCTGCTCCACACCGCCGTCGGCTACC
CAGCCACTCCGAGGAAGCAGCGTCGAGAGCGCACCACCTT
CACTCGCACCCAGCTGGACATTCTGGAAGCTTTGTTCACC
AAAACACGCTATCCAGACATATTTATGAGAGAAGAGGTAG
CTCTGAAAATCAACCTTCCCGAGTCCAGAGTTCAGGTGTG
GTTTAAGAACCGTCGTGCTAAATGCCGCCAGCAGCAGCAG
CAGACCAGCGGTCAGCCCAAGCCCCGTCCCCCCAAAAAGA
AGTCCTCCCCTCCCCCTGATCTGACCTCTGACCCTGGCAC
TAGCTCCTCGGTGGTGGCTGCCCCGACCCCGACCGTGCCC
CCTAGTGTGAGCGCAGGCACAGCACCAGTTTCTGTATGGA
GTCCCACTTCTCTTTCCCCCCTCCCTGATCCACTGTGTGG
TTCAGGCACCCCCTGCGTGCAGCGTCCTGCTCCATATCCC
ATGAGCTACGGTCAGCCCTCTTCCTACAGCCAGGGCTATG
GCTCTTCTCCTTACTTCAGCGGATTGGATTGCAGCCCGTA
CCTTTCTCCCATGACCACCCAGCTGTCAGCAAGTGGAGGC
GCCCTCTCCCCCCTCACCGTGCCCTCCATGGGCGGCTCGC
TCAGCCAGTCGCCCTCTCTCTCCTCCCAGGGATACAGCAC
TGCGTCGTTGGGCTTCAGTTCGGTAGACTGCCTTGACTAC
AAGGACCAGCAGGCCTGGAAGCTCAACTTCAGCACTGTGG
ACTGCCTCGACCACAAATTCCAGGTGCTGTAGAAAAGAAA
GTGAGAGAGAGAGAGTGAAGCGCAAGAGGGAAGGAAAGAT
GCGTGAAGAAGAAATGATGCAGAACTATTGCCGGAGACAT
TGTGATGATGAACAGGACTGAATCAGCGTGATTCATGTGA
TCTTAGAGGTGAAAAAAGGAGCACCCATTTTGGAACAGGT
GAAGACTGTTCCTCTGTAATCCAGATCTGCTCTGTGATTG
GCTGAGATTGAAGGGACTCTTCAAGTCTACTGATCAGTCA
TCATTATTAACCATTTACCTCACACATGCACACACCATTG
ACTAACTTTCACAATGCATACACACAAACACACATTGGTA
TTAATGGTTTATAAGGACATGCCATTGGCATTATGTATTT
TATACAGTTAAAACCATTTTTATATGACCCCACCCCTAAA
TCTGACCCTTCCAAGAAATCTGTGGCACATTTGAAATGTC
AATTTAAGCATTTTGAATTACAAGGACATAAGAAATGTCC
TCATAAACCACAGCAATGTTGTAATTCCTAGGTCATACCC
ATGTCATTATACATTTCTGTCCTTGTAAACCACAAAAACC
AGTACACACAGAAACAAAGACATGCACATAACTGGAGGGG
AATCTGTGTTTGTTTGTTTTTTTGCAGATACAGTTAGCTT
ATTGTTGGACAAAGTTGTTCTTTCTACTTTTTTCATGAGT
TTGGTTTGGTTTGTCTGTACTGGGAGACATTAGGAGTTCT
TGTGTCGTGCTTTTAGCTTGCTGTTATTTATGTATCGTTA
AATTATGTTAACTTATAACAAATAATGTTGTTTTCTGTTA
GTTTGAGTTAATCGTTACTAATTAAACTTCATTTAATGGC
ATCGTATGCATGCTATCGACATATGTTTTCTATTTGGGTG
ACCTTGTGTTGAAAAATGTTGGTGTTTACAAATGTCATTA
TGTTGCTTTGACTGAACACGTACAGAGGGGAGCTGAAGGT
TTTCATTTTTAATTAGTATTACTATTCCATTAATTGTGGC
TTTGTTTAACAACGTCTGTCTAACAAGAGTTGTCTGACTC
GCTTCTTGTTGATTATGCAAGATAAAGTATCAATGTAATT
AATAAAAAACATGGCTGGAAA

crx TRANSCRIPTS
Type Name Length (nt) Analysis
antisense ottdart00000059965 (1) 825
mRNA crx-201 2381
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
crx-201 Contained in:
[BAC] CH211-46E8 (1)

Genome Resources: Vega_Trans:OTTDART00000050095 (1),  Ensembl_Trans:ENSDART00000037879 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF503443 (1) 2385 nt
GenBank:BC059653 (1) 2379 nt
GenBank:EH595340 (1) 767 nt
CITATIONS (2)