Transcript

rdh8b-201

ID
ZDB-TSCRIPT-110325-1546
Name
rdh8b-201
Previous Names
  • rdh8b-001
  • rdh8l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049963 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049963|OTTDARG00000035149|ZDB-GENE-040426-1759 rdh8b|OTTDARP00000039209 rdh8l-001 LG_ CU550701.5 Danio rerio protein_coding KNOWN, 2088 bp
CGCGTGCCGTGTCCTCCTGCGCGCTCCCGCCTGCTGATTG
AGGCTCCGGTTCTCCGGTCAGTTCTCCGGTTCGGCGATGG
CGAGCGCGGGGCAAAAAGTAGTGCTGATCACCGGCTGCTC
CTCCGGCATCGGGCTCGGGATCGCCGTGATGCTCGCCAGA
GACAAGCAGCAGCGCTATTACGTCATTGCTACGATGCGTG
ACCTGAAGCGTCAGGATAAGCTGGTGTGTGCTGCGGGAGA
CACTTACGGGAAAACACTGACGGTGTGCACACTGGACGTC
TGCAGCAACGAGTCCGTCAGACAGTGTGTTGACAGCGTCA
AAGACCGACATATAGACATTCTGATCAATAACGCTGGCGT
GGGTCTGGTGGGCCCGGTGGAGGGTCTCAGTCTGGATGAT
ATGATGAAGGTGTTCGAGACTAACTTCTTCGGTGCGGTGC
GCATGATTAAAGAGGTGATGCCGGACATGAAGAAGCGGCG
CTCAGGACATATCATCGTCATCAGCAGCGTGATGGGCCTG
CAGGGTGTGGCCTTTAATGACGTTTACGCCGCGTCGAAGT
TCGCCATCGAGGGCTTCTGTGAGAGTCTGGCCGTGCAGCT
TCTCAAGTTCAACGTCACCATGTCGATGATCGAGCCCGGG
CCTGTACACACTGAGTTTGAGATGAAGATGTATGATGACG
TCTCCAAGAAGGAGTATCCCAACACTGACCCAGAGACGAT
GCACCACTTCAGGACCTGCTATCTGCCCACCTCAGTCAAC
ATTTTCCAGGGCCTGGGACAAACGCCAGAGGACATCGCCA
AGGTCACGAAGAAGGTGATCGAGTCTCCGCGTCCGCCGTT
CCGCAGCCTGACCAACCCTCTGTACACACCCATCGTGGCG
CTGAAGTACGCAGACGACTCCGGCGACCTGTCCTTACACA
CCTTCTACCACATGCTGTACAACCTGGGCGGAGTCATGCA
CGTCAGCGTGAGGATCATGAAGGTGCTGAGCTTCAGCTGT
ATGAGGAGACGAGCCGTATCCCCTGACTAACACACACACA
CACACTCACCTGTGGATGCTGGAGGAGAGAGCTGTATCAC
CCGACTAACACACACACACACACACATCTGTGGATGCTGG
AGGGTACGAGCCGTATCCCCTGACTAACACACACACACAA
ACACACACACCCACTCACACACACACCTGAGGATGCTGGA
GGAGGTGAGCTGTATCCCCTGACTAACAGACACAGTTTCA
TATAGTATATGAAGCACTATATTAGTGTATATTTTAAGCA
GATGAGACTTAGGACCAGATGATTTATAAAGTCTGTGTGA
AATCTAAATTCACAATATATATTTGCTAGAGCATATTAGC
TGTGTTTCCATCCAAAGATGTGAATTAGACATTATTAAAC
TGAAATATCTGCTCATCATCAGTGATAAATCAGCATCTCC
CTGAGTGCTGCACAGTAGAGCATCATCTCCTCAGCTGACT
GAATTCAGTAAACGTGTTCTCATTGTCGTTTATACACATT
TTCTATTGGATAAACGTTGATGCTACTCTGTTGTGTGCAT
AATCTTTTTTGAATGTGCATTTTGGCGTTTCCAGCAAGCA
TTTTTAATGCACATATCCAAAATGAGCATAAACATGAGAG
GATGGAAACAGCTGATGTTGTTCTGCAGGTTAACGATGAG
CACAAGTGAATCCACTGAAACTGAAATGTTCGCTTTGGTT
ATCTTCAACCTGAGCATCTGCTTGGATTTGCTTTGTGACG
TCAGCTTGACTACAGAAAAAATATTCGTAGCCACGCCCCC
TTACCACTAGTTTACTACGACTCCGCCCCCAACTCAATAA
CATTCCATTTGGAAATATGTCAGCATAATGAAGCAAACAT
CTCAGCAACTCCTGATTCACTTTAAAGTCAAACTCATGTT
CCTGTCATATAAAGCTGTTGATAAGCTCAGTGAGACTTCA
TAAAGCTGAGGAAGACTGTCTAGTGAAGCAGCAGTAGATC
CTGAAGAACAGCGTGATAAACAGCTGATCTGTAGAACTGT
CAATACATCAAATCAACATGAAGACAAATAAAGACGACTT
GGCTTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations