Transcript

usp25-201

ID
ZDB-TSCRIPT-110325-1527
Name
usp25-201
Previous Names
  • usp25-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049874 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049874|OTTDARG00000035091|ZDB-GENE-040426-2847 usp25|OTTDARP00000039133 usp25-001 LG_none FP016248.7,CU929169.8 Danio rerio protein_coding KNOWN, 4049 bp
AGAGATGTCAGATGTGACTGTACTGCTCGTGTTCGTCATG
GCGCCGTTGCAGCGCGGATGAGAGTACAGGCTTTTTCGTT
TTTAAACTTTCCTGTTGAGCTCGTAGAACTCCTGTATGCT
CCATTTTTACCGTCAAATTTGAGTCCTAATCGCCTGCATC
GGAAGCGGCCATGACCGTGGAGCAGAATGTCCTGCAGCAG
CACTCTCAGAAGCACCAGCAGACATTACTGAACCAGCTGA
GGGAAGTTACTGGAACTACAGATGTTCAACTGTTACAGCA
GGCACTGCAGGTCAGTAATGGTGACCTAGTGGAGGCTGTT
GCCTTTCTCACTGAGAAGAACGCCAAGGTCCCGCAGCAAG
ATGAAGCCACCTATTACCAGACGGCCCAAATCACCAACGA
CAGATACATCAGCGTGGGCAGCCAGGCTGACACAAATGTA
ATTGACCTGACTGGAGATGATAAAGATGACCTCCAGCGGG
CCATCGCTCTCAGTCTGGAGGAGTCAAACAGAGCCTTCAG
GGAGACGGGCATCACCGATGAAGAGCAGGCCATCAGCAGA
GTCCTGGAGGCGAGCATCGCAGAGAACAAGGCCAGCCTGA
AGCGAACACACACTGAAGTGTGGAGCGATTCACCAAACCC
TCACGAGCGCAAGAGAATGGAGAACTGTCCTGTAGGACTG
AAGAATGTGGGAAACACTTGCTGGTTCAGTGCTGTTATAC
AGTCTCTTTTTAACCTGCTGGAGTTTCAGAGGCTGGTGTT
GCATTATTCCCCTCCTGCACGGATGCAGGACCTGCCCCGC
AATCAAAAGGAGCACAGGAACCTGCCCTTCATGCAGGAGC
TTAGGCATCTCTTCTCCTTGTTGGTGGGCTCCAAGCGGAA
GTATGTGGACCCGTCCGGGGCCGTGGAGATCCTCAAAGAT
GCCTTCAAGTCCAGTGAGTCTCAGCAGCAGGATGTGAGCG
AGTTCACCCATAAACTTCTGGACTGGCTGGAGGACGCATT
TCAGATTAAAGCAGAAGAGGACAGGGAGGGAGAGAAACCC
AAGAACCCGATGGTTGAGCTGTTTTATGGACGTTTCCTGG
CTGTGGGCGTCCTGGAGGGAAAGAAATTTGAAAACACTGA
GATGTTTGGCCAGTATCCTCTCCAGGTGAACGGCTTCAAA
GATCTACACGAGTGTTTAGAGGCCGCCATGATAGAGGGAG
AAATCGAGTCTTTGCATTCTGCAGAAAACTCCGCCAAATC
AGGCCAAGAGCATTGGTTCACAGAGCTTCCACCCGTTTTG
ACCTTTGAACTGTCCAGGTTTGAGTTTAATCAAGCCTTAG
GCCGACCTGAGAAGATTCACAATAAGCTCGAGTTTCCTTC
TATGCTGTACATGGACAGGTACATGGACAGGAACCGAGAG
ATCACACGGATAAAGCGAGAGGAGATCAGAAGACTAAAGG
AGCACCTCACCGTCCTCCAGCAGCGACTCGAGAGATATCT
GAGTTATGGCTCGGGGCCCAAGCGCTTTCCTCTGGCTGAT
GTTCTCCAATATGCCATGGAGTTTGCGTCCAGTAAACCAG
TGTGCACGTCTCCAGTGGAGGACATTGATACAACAGCACC
ACCTGGTGGCACAATTGCGCAGCTGCCACCGCCAGCAAGC
GCAGGGGAACAGCCGGATGCGTGCGTCTCAGCCGAGGGCT
CTGGTTCTGGTCTGCAGGCTTCGCAACAGCAGCAGCAGAG
GGTTTCCATCCATAAACCGTTCACACAGTCCCGAGTGCCG
CCGGATCTGCCCATGCATCCCGCTCCTCGACACATCACTG
AGGAGGAGCTGCGGGTGCTGGAGAGCTGCCTGCACCGCTG
GAGGAGCGAGGTGGAGAACGACACCAGAGATCTGCAGGCC
AGCATATCCAGAATCCACAGAACTATCGAGCTCATGTATT
CTGACAAGTCTATGATGCAGGTGCCGTATCGACTACATGC
TGTTCTGGTCCACGAGGGTCAGGCGAATGCTGGTCACTAC
TGGGCCTACATTTATGACCGACATCACCAGCGCTGGATGA
AATACAACGACATTGCAGTGACAAAGTCATCATGGGAAGA
GCTAGTGCGGGACTCGTTTGGTGGATATCGTAACGCCAGC
GCATACTGCCTCATGTACATTGATGATAAGAAACCCTTCC
TTATTCAAGAAGAGTTTGATAAAGAGACGGGACAGATGCT
CAGTGGTTTGGACAAGCTTCCTCCTGACCTGAAGGTGTTT
GTGGAGGCAGATAACAAGCTCTTCGAGAGGGAGATGGAGG
AGTGGGATGCTTTACAGGCCCGCAAACTCCAGCAGGAAAA
GTTGGCTCTGGCTGCTGCTGCTGCGGCTGCTGCCGCCGCT
AGTGTGGCCGTCCAGCCCATGAGCACTGAACCCTGCTCTC
CAGACAACACAGCTCCTCAGCATGACCCAGAGTACATGGA
GCAACAGTCGCCCAGCGGAGACTCCAAACACCTGCAGGAG
GACACAGAGAGAGCCATCAGCAAGGCTGCAGCGGAGCATG
ATGAGAAGAGTCCAGAAGCTCTGCTTAATACAGCGATGAA
GGTTGAGTACACGCGTTTGCTGAGGCTTGCTCAGGAGGAC
ACGCCGCCCGAGAGAGACTACCGGCTACAGCATGTCATTG
TGTTCTTTATTCACAATGAGGCGCCCAAGAAGATTGTGGA
GAGAACATTGCTCATGCAGTTTGCTGACAGAAACCTTGGC
TTCGATGAGAGGTGTAAAAGCATCATGAAAGTGGCACGTG
CCAAACTGGAGCTCATCAAGCCTGATGAGGTGAACTTGGA
GGAGTACGAGATGTGGCATCAGGACTACAGGATTTTCCGT
GAGACGTCAGTGTTCCTGTTGATCGGCCTGGAATTATTCA
TGAAGAAAAGTTTTGTGGAAGCGTTGATGTATCTGATCTA
CGCCTATCAGTACAACAAAGAGCTTCTGGCGAAAGGGCCG
TACAGAGGCCATGATGAGGAGCTGATCGCACATTACCGCA
GAGAGTGCCTGCTGAAGTTAAATGAATACGCTGCCGCTTT
GTTCGAGACGGGCGAGGAGGCTAAAGTGAACACGGGTCTG
AGCATCATGAACGATCTGGTGGTGCCCTGTCTTCCTCTGT
TACTGGTGGATGAGATGGAGGAGAAGGACATGGTGGCTGT
TGAAGACATGAGGAACCGATGGTGCTCATACCTGGGCCAG
GAAATGGAGCCGAATCTACAGGAGAAGCTGACCGACTTCC
TCCCCAAACTGCTGGACTGCTCGACCGAGATCAAAAGCTT
TCACGAGCCGCCCAAACTGCCCTCTTACTCCACGCTGGAG
CTGTTCGAGCGCTTCGGCAGGGTCATGACGTCCCTCACTA
TGGGTCGAACCCCTGCAGATGGCAGATGAGCGGCGCAGAC
TTCATCTCCTCTCCACTAACACACACACGCCTTCCTTAAA
GCAGGACTTTCCCAAACCTGCTCACCTTTCCTTTCACTTT
TGCTGCTAGAGATTTTATCCTTATTGGTATTATTAATATT
ATTTCTCGAGGATTCTGTTATGTTTTACAGCTAATGCTAC
AGTAAGGATAGCGTGAAGCTGAGCAGAAGCTAAGAAAGAA
TGCATTCGATGGATAGTTCACCTAAAAATAAATGTTATAA
AGGATTTGAAGGTAAATGAATAACAAGTGATGATTTTCGT
GTGAACTATCCCGGGTTTCATGGTGGTGCTTTAGACATTG
GCGCATGCAGCTTTAGCTTTGTGAAACGAGGTTGAGGATT
CATTTCAATATTTGGTTTTAAGTTTTATCCCCTCCCCTTC
GTTCCTTTTCACACCGGAAGCAGATCGACCGGCCGCACCG
CCCTCGTTTTGTTACAGTGTTACCACATTTTTTTTTCGTT
TGGTTTTGTTTTTCTAAGGACGGTGAGACAAAAAGCTGGA
GGTTCTCGGATGGGTCTGCCCACCAGACGACCGGGACTTC
AACACAAGTTTTAAGTGCTGTGGATGGCAGCCATGGGACA
TACTGTGGCTTGTTAATACATTGAGAGAATAAAATTTTAT
TTATGGCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations