ZFIN ID: ZDB-TSCRIPT-110325-1478
Transcript Name: nocta-201
Previous Name: nocta-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049615 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049615|OTTDARG00000034938|ZDB-GENE-050208-306 nocta|OTTDARP00000038923 ccrn4la-001 LG_ AL929007.6 Danio rerio protein_coding KNOWN, 3390 bp
GACAGTAGAGCCAAACCATTTATCGTTTGGTGGGTGAACA
TCGCGTTGCAAAATTGGCCGTTTTGTAGTTTTTGCTACAC
GTTTTGATTTATTTATTATTTAGGTATGATAAAACCAAGA
TTATAATTTCATTAATATAAGCAATACTTAAATGATTGTG
TGATTATATCAACTTACAAAACTCAAATCTTGGAACTCCC
CTGTTAAACTATAGTTCACGTGTCAGCCTGGAATATGATG
ACACTTCTACCGGCATTTTTTCCATACAGCGAAAAGACAA
CGAAACTTGTCTAAGTAGCGTTAAAATGGAGAGTGTTATA
TAGGTTGTCTTAACTTTTTCATCGTAAAGCGATTAGATTA
AGTGAATTATTGTGAAGGACGAACGACTGGAGAATAATAA
TAATGTATCCCGCCCGGCGCTGTTCATCACTGTTTCACCG
AGACCTGGCCGCAGTCTGTCTGTCATCATTGGGGACACAT
CCGAAAAAATCTGCTCAGCCAAAGAAAAACAGCCTTCAGA
GTTCACGACACCGGTCAAACTCATCGCCTCTGCTTCTCCG
TCGTTTACAAGTGTGTCAGATGGGCAGCAACAGCAGCAGT
AGACTCTTCAGTACTCTGGCCCAGACTCTGAGCAGCGCTG
CATTGACAGACCCACATGTGGATGCTGATGACTATGAGTA
TGAGCAGGCCGATCCAGACGTGCTGCTGCGTGAGTGCGGA
GAGGTTTTGAGGAATCGACCGCCTCGACTGCACCGGGAGT
TCATCATGACCAGAGCCTGTTCACTTCAGAATTCACCCCT
CCGCATCATGCAGTGGAATATTCTAGCTCAAGCTCTTGGC
GAAGGCAAAGATGGTTTTGTGCGCTGTCCAATGGAGGCGT
TGAACTGGTCGGAGCGCAAGTATCTCATCCTAGAAGAGAT
CCTCACCTACAGGCCAGACGTGGTGTGTCTGCAAGAGGTG
GACCATTACTTCGACACGTTCCAGCCTGTGCTCTCTAGCC
TGGGTTACCAGAGCAGCTTCTGCCCCAAACCCTGCTCCCC
CTGCCTGGACGTCCACAATAACAACGGCCCGGACGGCTGC
GCTCTGTTCTTCAACCGCCGCCGCTTCCAGATGCTCCACA
CGGCGCATCTCAGACTCTCCGCCATGATGCTCAAAACCAA
CCAAGTAGCCGTCGTCGCTACGCTTCGATGTAAGCTCACA
GGACGAGTTTTCTGTGTCGCCGTAACGCATCTCAAAGCAC
GAAGCGGATGGGAAGCATTTCGTAGTGCGCAAGGAGCAAA
TCTCCTCCAGCAGCTTCACGAAATAACCTCCCAATCAAAC
CCAGAGATGCATCAGGACGACCAAACAGAGGGTATTCCTT
TGATAGTGTGTGGGGATTTTAATGCAGAGCCCAACGAGGA
AGTGTATCGGCATTTTAGGAGTTCTTCATTAGGGCTAGAC
AGCGTTTATAAATGTCTAAGTGACGACAGGACCACTGAGC
CGCCTTATACAAGCTGGAAAATCCGGCCTAGTGGAGAGTG
CTGCTCCACGCTGGACTATATTTGGTATTCGGAGAAAGCC
TTCGAGGTGGATGCTGTGCTGAGGATACCGAGTGAAGAGC
AGATCGGCCCGGACCGGCTTCCTTCATTTCATTATCCGTC
AGATCATCTGTCTCTGGTGTGTGACCTCAGCTTCAGTCAG
CAGCCTCATAGGCTCATGTAGCTGTCAATCATTCATGCAG
ACGTTATTAGAGCTTGTGTGTGTGTGTGCGTGTGTGTTTG
TCTGAATGTGAGAATGCATTAGTTGTATTATAGCGCAGAA
TGTAACTTATTCACATACACCTTATAGGTATGGAGGACGA
AACTTGCAAAAACAATAAATAAATAAGCAAATAAATAAAT
ACACAAATTCCTGCATAAGACAATAAATAAATAATTAAAT
AAATAAATTTAAAATATGCACATAAAAACCAATAAATTCA
CAAATAAATGAATAAATATACACACAAATTACTGCATAAA
TTAAAAAAATAATAAATTAGCAAATAAATTAATTAATTAA
TAAATAAATACACAAATTCCTGCATACATAAAATAATTTA
AAAAATGCAAATAAACAATAAATAAATAAGTAAATACGCA
AATAAAAAAATTAATAAATAAATACACCCATACCTGTATA
AATAAACCAAATAAATATGCAAATAAATAAATTGACAAAA
TCCTGCATAAATAAAACAATAAAAAAATATGCAAATAAAT
AAATAAATTGACAAATTCCTGCATAAATAAATAAATAAAT
ACACAAATAGATAAATAAATGTATATATAATTCTACAAAT
TCCTGCATGAATAAATATATAAATAATTAGTAGTGCGGTG
TAAAAGCGGGAAGAATCTATTTTCAGTTTAGCATTTCCTT
ATTCCACCAACATCCGTGTAATTTATTTAATTATTAATCT
GCCCACACTATTTATATATTTATTTATGCAGGAATTTGTG
TTTTTTATGTATATTCATTTATTTATTTGCATAAATATTT
ATGCAGGAATATGTGGATTTATTAATTAATTTATTTATTT
ATTTATATATTTGTTGTTATTGCAGGTTTCGTCCTCCATA
TATTTAGACCTGCTGATGTAGGTCTGAAGGGGGTAGTTCG
CACAAAACTGAAAATTTTGTCATTATTTCCATTCAAATCT
GTATTTTATTTCCATTCAAATCTGTTTGAGTTTCTTTCTG
CTGTTATCTTAAACTATAATTAAGATGTTTTGAAGAAAGC
TGGCAACCAGGGATTTTTACAGTATCTATTTTTCCTACAT
TCAAAATAAAAAAGTAGTAAATTAAATGTTTTTTAAGGTA
AGTGGTTGCAAACAATTTATATTGGCTAAATTTAAACAAA
CAAATTAATTTGAACATTACTAAATTGTATTTGTTTAAAT
TCAGCCCATATCAATTGTTTGCAACCACTTACATTAAAAA
AAAATGTAGTAATACCAATTAATGATTTTTTTCAGTGTAC
TACAGAAGTCAATGGTTGCAGGTTTTCAGCATTCTTCAAA
ATATCTTCTTTAACGTTCAACAGAGTACTCATAACTGTTT
AGAACCACTTGAGAGTGAGTAAATACAGAGAAAAATTTCC
ATTTTGAGTAAACTATGCCTTTATTGCACCTCCGTGCTGC
TTATTTTCCTTGATGGAGATGAATGATGAGGCTCTTATTG
TTGTTGTTATACAGAGGTTATGCGGTATACTGTAATTTAT
TAAGATCTCAGGAAGATGTGTATTCTTGATTTAAAGTGGA
CAAATGAAAATATGTTTCTATTTATATTTACTGTAGTTAT
TTCTATAAGTAATACTGTATTCATTCATATGTTTGCCACT
GACCAATAATATATAAAACATCACAGTATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nocta-201 Contained in:
[BAC] CH211-235E9 (1)

Genome Resources: Vega_Trans:OTTDART00000049615 (1),  Ensembl_Trans:ENSDART00000113469 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK685326 (1) 737 nt
GenBank:EB912577 (1) 434 nt
GenBank:EB899881 (1) 423 nt
GenBank:CD592031 (1) 333 nt
CITATIONS (2)