Transcript

arhgef3-002

ID
ZDB-TSCRIPT-110325-1377
Name
arhgef3-002
Previous Names
  • ch211-258l4.8-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049289 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049289|OTTDARG00000011535|ZDB-GENE-050208-773 arhgef3|no_translation CH211-258L4.8-002 LG_ AL953867.18 Danio rerio protein_coding NOVEL, 792 bp
CACCAGGCCGATGGTGCAGGGGAAGGAGTCGTTTTCTCTC
CTCTCCACATCAGAGAAGTGGCTCTTCAAAGGGAAGAAGA
GGAAGCAGAGGAAGAGAGATGTGGATTCACTCAGTCTGTG
CAGCCTGGACATCAACGAACCCAGCACCAAGCGGGTGAAG
CCTCTGTCTCGGGTGACGTCGCTGGCGAGTCTCATTCCTC
CAGTTAAAGCTGCTCCACTGAAGCGCATCGGACAGACACT
GCAGCGGTCCATCAGCTTCCGCAGTGACTGCAGACCGGAG
ATTATGGCACCTCGGCCGTGGAGCAGGCAGGTTGTGCCGA
CCATCACCAAACGGCGTGACAGCAAGCTGTGGAGCGAGAC
GTTTGATGTAGGCCTGGGACATATGCTATCCTCCAAAGAA
ATCAAGAGACAAGAGGCCATCTTTGAGCTGTCTCAGGGAG
AACAGGACCTGATTGAAGACTTGAAGCTGGCCAAGAAGGC
ATATCACGACCCTATGCTGAAGCTGTGTATTATGACGGAA
CATGAACTCAATCAAATATTCGGCACGCTGGACTCCCTCA
TTCCACTACATGAAGATCTGCTGAGTCGCCTGCGAGACGT
CAGGAATCCGGACGGCTCGACTGATCATATGGGCCATATT
CTAGTCCACTGGCTCCCTTGTCTTGAAACCTACAACAGCT
ACTGTAGTAACCAGGTAGCAGCGAAAGCCTTGCTGGACCA
TAAGAAGCAGGACCATCGGGTGCATGACTTTCTTCAGCGC
TGTCTGGAATCACCCTTTAGCCGAAAACTGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations