ZFIN ID: ZDB-TSCRIPT-110325-1342
Transcript Name: kpnb1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: artifact
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049180|OTTDARG00000034702|ZDB-GENE-030131-2579 kpnb1|no_translation kpnb1-002 LG_ CU929079.6 Danio rerio protein_coding KNOWN, 974 bp
CGGCCTTTTCCTCGCGACAGCGGCTGATGAGCAGAAGCGG
TAACCGCGAGAACGGCTCGGCGCTTCAGCATTAGGCGTGG
ACCGACCGACTTTACCGACCGACTGCACTCGTTCTGCCCC
CGCGGACCCGACAGGATGGAGCTGATCACGATCCTCGAGA
AGACCGTGTCTCCAGATCGGAATGAGCTGGAGGCGGCACA
GAAGTTTCTGGAGCAGGCGGCCATCGAGAACCTGCCGACC
TTCCTGGTGGAGTTGTCCAAGGTGTTGGCGAACCCGGGGA
ACACACAGGTGGCTCGCGTCGCCGCCGGCCTGCAGGTCAA
GAACTCTTTGACCTCTAAAGACCCGGAAGTGAAGAGTCAG
TACCAGCAGAGATGGCTGGCTATCGACACCAGCGCACGCA
GGGAGATCAAGAACTACGTGCTGCAGACGCTGGGCACAGA
GACGTACCGGCCCAGCTCCGCATCTCAGTGTGTGGCGGGC
ATCGCCTGCGCAGAGATCCCAGTAAACCAGTGGCCGGAGC
TGATCCCACAGCTGGTGGCCAACGTGACGGACCCCAGCAG
CACCGAACACATGAAGGAGTCCACGCTGGAGGCCATCGGC
TACATCTGCCAGGACATAGACCCAGAGCACCTGCAGGCTC
CGGCGGAGCGACGGGATATTAGACACCTCCACACGCGACT
TTATTCTCCTTTATTTGTTTTGCAGGAAACTGAGTGCCAA
ACCCAGCGGTGCAGATGGACTTGAGCTTAATGTGTTACTC
GTAGAAGATGCGAATTAATAATACACACGTCAGCGGCGGC
GAGCCGAGCAGCATCCATGTGCTTTTGGTTGTAATTTTTT
GTTTTGTTTTCCTCTTGCGGCACTTAATTGGAGTCATTCA
CCGAGCTTTTAAGAAGACGACGACGGACAGAATCAGACAT
TTGTATGAGGTTATATTTTTCCATTGATATGAAAATAAAG
TTAAATTAAATCTT

kpnb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA kpnb1-002 974
mRNA kpnb1-201 (1) 3774
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kpnb1-002 Contained in:
[Fosmid] CH1073-205C8 (1) (order this)
OTHER kpnb1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049180 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC107501 (1) 1000bp
    CITATIONS (1)