Transcript

itpr1a-202

ID
ZDB-TSCRIPT-110325-1222
Name
itpr1a-202
Previous Names
  • itpr1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048756 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048756|OTTDARG00000034462|ZDB-GENE-070604-3 itpr1a|OTTDARP00000038260 itpr1a-001 LG_ BX957338.16 Danio rerio protein_coding KNOWN, 8747 bp
GAACATCATCGGGGCGATGGACCGCTGCTGGACTTGATGA
AGAGTCGGGATAATAACTTTCTCAAACAGTGGACGCAACG
TTTGGGAAAATACCGACACTATTGCCCCAGCTTCGTCGGA
GAGAGGTGCTGGAGTTTTTGCCATGGTGGACAAATTGTCT
AGTTTCCTGCACATTGGGGACGTTTGTTCCCTTTATGCTG
AAGGCTCTACTAGTGGCTTCATCAGCACTCTGGGGTTGGT
TGATGACCGATGTGTTGTTCAACCAGATGCCGGAGACCTG
AATAACCCACCTAAAAAGTTTCGGGACTGTCTGTTCAGAC
TGTGTCCCATGAACAGATATTCGGCACAGAAACAGTTCTG
GAAAGCTGCCAAACCTGGAGGAACTAGCACCACAGATACT
GTCCTGCTTAACAAACTCCATCATGCTGCTGATTTAGAGA
AGAAACAAAATGATTCTGAGAACAAAAAGCTGCTTGGAAC
CGTCATTCAGTATGGCAATGTCATCCAGCTTCTCCATCTG
AAGAGTAATAAATATCTGACGGTGAACAAGCGTTTGCCGG
CTCTTCTTGAGAAGAATGCCATGCGTGTGACGCTGGACGC
TGCAGGGAATGAAGGCTCGTGGTTTTACATCCAGCCCTTC
TATAAGCTGCGCTCTATAGGGGATAATGTGGTCATTGGAG
ATAAGGTCGTGTTAAACCCTGTCAATGCCGGACAGCCGCT
GCACGCCAGCAGCCATCAGCTTGTGGATAATCCAGGCTGC
AATGAAGTGAATTCAGTGAACTGCACCACCAGTTGGAAAA
TCGTTCTCTTCATGAAATGGAGCGACAACCAGGAGATTGT
CTTGAAAGGAGGTGACGTGGTGAGGCTGTTTCATGCAGAG
CAGGAGAAGTTTCTGACATGTGATGAGCATCGGAAAAAGC
AGTATGTGTTTCTGCGTACCACCGGACGCCAGTCTGCAAC
CTCCGCCACTAGTAGCAAAGCACTCTGGGAGGTGGAGGTG
GTTCAGCATGATCCCTGCCGAGGTGGAGCCGGCTACTGGA
ACAGCCTCTTTAGGTTTAAACACTTAGCCACCGGCCATTA
CCTTGCTGCAGAGGTAAATCCAGACTATGAAGAAGAATGC
CTGGAGTCCCGCTCCTCTATGGATTCGGAGCATGAAGTGA
TTCGGGCTCGTGCACGTAACCCTCAGGATAAGGTGATGTA
CACACTGGTGTCTGTTCCTGATGGAAATGACATATCCTCC
ATCTTTGAGCTTGACCCTACAACTTTGAGGGGCGGAGACT
CACTTGTGCCAAGAAACTCGTATGTGAGGCTCAGGCATCT
CTGCACCAACACGTGGGTCCACAGCACCAACCAGCCAATA
GATAAAGAGGAAGAGAAACCGGTCATGCTCAGAATAGGAA
CGTCTCCTCTGAAGGAAGATAAAGAGGCGTTTGCTATAGT
ACCAGTCTCTCCAGCTGAGGTTCGAGATCTGGATTTTGCT
AATGATGCTAGTAAAGTGTTGGCTTCCATTGCTGCCAAAC
TGGAGAAGGGCACCATTACCCAGAATGAGAGGAGGTCAGT
GACGAAGCTGTTGGAGGATCTGGTGTATTTTGTGGTGGAC
ATACCCAGCAGTGCTCAAGATGTGCTGGAGATCACAGTCA
ACAAACCCAACAGAGAGCGACAGAAACTCATGAGAGAGCA
GAACATTCTTAAACAGATCTTCAAGCTGCTGCAGGCGCCA
TTTACAGACAGCGGGGACGGCCCTATGTTGCGATTAGAAG
AGCTCGCAGACCAGCGTCATGCACCCTTTCGACACATTTG
CAGACTCTGTTACAGAGTCCTACGTTACTCACAACAGGAC
TATCGCAAAAATCAGGAGTACATAGCAAAGCAGTTCCGCT
TCATGCAGAAGCAGATAGGATATGATGTGCTGGCTGAAGA
CACAATTACAGCCCTTCTGCACAACAACAGGAAGCTCCTA
GAGAAACACATCACAGCAGCTGAAATAGATACCTTTGTCA
GTCTGGTCCGCAAGAACAGAGAGCCCAGATTTCTGGATTA
CTTGTCAGATCTGTGTGTGTCGATGAATAAATCCATCCCG
GTCACTCAAGAGCTCATCTGTAATGCTGTGCTGGACCCAG
CCAATGCAGACATTCTCATCGAAACCAAGCTTGTGTTGTC
ACGGTTTGAGGTGGCAGGAACGGTGTTGGGTGAAGGTGCG
GAGGAGGAAGAGGAGGATGAAGAGGAGGTCTGGCTGTTCT
GGAAGGACAGTGGAGGAGAGGTGAAGAGTAAAAGCATACG
AGAGCTTGCACAGGACGCAAAAGATGGACATACAGAGGAC
CAGGAAGTCATCAATTATTACAGATATCAGCTGAATTTGT
TTGCTCGGATGTGTCTGGATCGACAGTATCTTGCGATTAA
CAAGATATCAGCACAGCTGGATGTGGATCTGATTCTGCGC
TGCATGTCAGATGAAGATTTGCCCTTTGACCTCAGAGCAT
CGTTCTGCCGCATGATGCTGCACATGCATGTAGACCGTGA
CCCTCAGGAGCAGGTCACCCCGGTCAAATATGCTCGACTG
TGGTCTGAAATCCCATCACAAATTTCCATTGATGATTATG
ATAATGATGGGACGTCAAGTGATGAAGTGAAAGAGCGCTT
CTCTCAGACGATGGAGTTTGTGGAGAATTACCTGAGGGAT
GTTGTCTGCCAGAGTTTCCCGTTCTCTGATAAGGAGAAAA
ACAAACTCACTTTTGAGGTGGTGAACCTGGCAAGAAACCT
GATCTATTTTGGTTTCTATAACTTCAGTGATCTGCTAAGG
TTAACAAAAATCCTATTGGCAATCCTGGACTGTGTCCACA
TAAGCACTCCCTTCCACATCAAGCTGGATAGAGAACCCGG
TAAAGGAAGTAACGTGATGCGCTCCATCCATGGGGTGGGA
GAGCTGATGACACAGGTGGTGTTGAGGGGTGGGGGATTTC
TGCCAGCCTCCAGCCACAATCCTCCTGACAGAGACGAAGT
GAAAGCACAAAGTGAACCTCAGAAACAGGACATACTGGTG
ATGGACACTAAACTCAAGATCATCGAGATCCTGCAGTTTA
TTCTGAATGTGCGGTTGGACTACAGGATCTCCTGCCTCCT
CTGTATCTTTAAGACAGAGTTTGATGAAAGTAACTCTCAA
AGTGAACCATCTTTAAGCCCAGAATCTCCTGCCAGCGTTC
AAGGTGCGCTAGACTTTGAGCACATTGAAGAGCAGGCGGA
GGGTATTTTTGGAGGAAGTGAAGAGAACACCCCGCTGGAT
CTTGATGATCATGGTGGACGGACATTTCTGAGGGTCCTGC
TTCACCTGACCATGCATGACTATCCTCCGCTGGTATCTCG
AGCTCTTCACCTGCTCTTCAGACACTTTAGCCAACGCCAG
GAGGTCCTACAGGCCTTCAAACAGGTTCAGCTCCTGGTGA
CCAGTCAGGATGTGGAAAACTATAAACAGATCAAGTCAGA
TTTGGACCAGCTGAGGTCAATAGTAGAGAAATCAGAGTTG
TGGGTGTATAAGAGACAAGGCTCAGACTCAGGACTGGATG
CTGGAGAAGTCACCCCTGAAGCCCACCACAAGGGTGTCAT
CAACTCGAGTAGATCAAACAAACCCAAAGTGGAAAGTACC
AGCAGCTCGAACTACAGAGTCGTGAAAGAGATCCTGCTGA
GGCTGAGCAAACTGTGTGTTTTGGAGGGCATCTCTGGCAA
GAAGAATAAGAAACAGCAGCAGCGGCTCCTCAGGAACATG
GGAGCTCACAGTGTGGTCCTCGAACTGTTGCAAATCCCTT
ATGAGAAGGGGGAGGATGTCCAGATGCAGGAGATCATGAC
CTTAGCACATCAGTTCCTTCAAAACTTCTGTGCTGGAAAT
CAGCAGAACCAGGCACTTCTACACAAACACATCAACCTGT
TCCTCAACCCTGGGATCCTGGAGGCGGTGACCATGCAGCA
TATCTTCATGAATAATTTCCAGTTGTGTAGTGAGATTAAT
GAGCGGGTCGTGCAGCATTTTGTGCACTGCATCGAGACAC
ACGGCCGCAGCGTGCACTACCTCAAGTTCCTGCAGACCAT
TGTCAAGGCAGAGAACAAGTTCATCAAGAAATGCCAAGAC
ATCGTCATGGCTGAGCTGGTGACTGCAGGTGAGGATGTGC
TGGTGTTCTATAATGACCGGGCGTCTTTTCAGTCATTGGT
TCAGATGATGCGTCTTGAGCGGGAACGACTTGATGAGAGC
AGTGCACTCAGGTATCACATTCACCTGGTGGAGTTGCTGG
CTGTGTGCACTGAAGGCAAGAACGTCTACACTGAGATCAA
ATGCAACTCGCTGCTCCCTCTCGATGATATTGTACGTGTG
GTCACACATGAGGACTGCATCCCTGAGGTGAAGATGGCCT
ACGTGAACTTCCTGAATCACTGTTATGTTGATACAGAGGT
TGAGATGAAGGAGATCTACACCAGCAATCACATGTGGAAA
CTTTTTGATGATTTTCTGGTGGACGTCTGCAGAGTGTGCA
ATAACACAAGTGACCGTAAACACGCTGACACAGTTCTGGA
GAGATACGTTACAGAGACCATAATGAGCATCGTCACCACC
TTTTTCAGCTCACCATTCTCAGACCAGAGCACAAGTTTGC
AGACCCGGCAGCCGGTGTTTGTGCAGCTGCTGCAGGGAGT
GTTTCGTGTATATCACTGCAACTGGCTTCTCCCAGGTCAG
AAGGGGAATGTGGAAGCCTGCATCAAAGTGCTGAGTGACG
TGGCCAAAGGCAGAGCCATAGCCATTCCTGTGGATCTGGA
CTGTCAGGTGAATAATCTGTTCATGAAGTCCAACAACATT
GTGCAGAAAACAGCCCTCAGCTGGAGACTCTCTGTCCGTA
ACGCGACTCGGAGAGACTCTGTTCTGACCACCTCTCGAGA
CTATCGCAACATCATTGAAAGACTACAGGATATAGTGTCT
GCATTGGAGGAGCGGTTGAGGCCTCTGGTTCAGGCTGAGT
TGTCAGTGTTGGTGGATGTTCTCCATCGCCCAGAGCTGCT
GTTTCCAGAGCACACTGAAGCCCACCGCAAGTGTGAGAGT
GGAGGCTTCATCTGCAAGTTGATAAAACACACTAAGCAGC
TTCTAGAAGAAAACGAAGAGAGGCTTTGCATCAAAGTCCT
TCAGACACTCCGAGAGATGATGACCAAAGACAGAGGATAT
GGAGAGAAGGGGGAGGCCCTTCGGCAGCTGCTCGTCAATC
GTTACTATGGCTTCAGGAGTGGTGGGCGGAGAGAAAGTCT
GACCTCGTTTGGTAACTCCACCCTAACTCCTGTCGGGCCA
ATCAAGAGCCAGCCAGGGGGGTTGAGCAGGGCTGAGATGT
CATTAATGGAGGTGCAGTGTCATCTAGACCGTGAAGGGGC
ATCGGATCTTGTCATTGATCTCATCATGAACACTACCAGC
GACCGCGTCTTCCATGAAAGCATTCTGTTGGCCATCGCAC
TGTTGGAGGGCGGAAACACCATCATACAGCATTCCTTCTT
CAAACGTTTAACAGAAGACAAAAATTCAGAGAAGTTTTTC
AGGGTGTTTTATGACAGAATGAAAGTGGCTCAGGTGGAGA
TCAAAGCCACGGTTACTGTCAACACTAGTGACCTCGGCAA
CAAGCGGCGTGACGACAACACTCCAGACAAAGATACTCCA
CAACGCCGCAGAGGTAAAGACTCCGGTGTGGTGGTGACAG
ATGATGCTCGTGAGCAGCTGTTGGAGGCTTCAGCTGCGAC
TAAGAAGGCCTTTGGTTCATATCGTCGAGATGCTGATCCC
GAGGAGACGTTTGGCACGGCTGATGGAGATAAAGGAGGTG
GAGATAAAGGCACAGAGCAGGGCGAGATGAGCCCTGTCAT
CCTCATAATGCAGCCAATCCTGCGCTTCCTGCAGCTGCTG
TGCGAAAACCACAATCGAGACCTGCAGAATTTTCTGCGCT
GTCAGAACAATAAAAACAACTATAATCTGGTGTGTGAGAC
GCTGCAGTTCCTGGACTGTATCTGTGGCAGCACAACAGGA
GGCCTGGGGCTGTTAGGACTCTACATCAACCAGCATAACG
TAGCGCTCATTAATCAGACTGTAGAGAGCCTCACTGAATA
CTGTCAAGGTCCCTGCCATGACAATCAGAATTGCATTGCC
ACCCATGAGTCTAATGGCATCGACATCATTATTGCACTGA
TTCTGAATGATATTAATCCACTGGGCAGGAAGAGAATGGA
TCTGGTTCTAGAACTAAAGAATAATGCATCTAAGCTGCTG
CTGGCCATCATGGAGAGCCGTCATGACAGTGAGAATGCAG
AAAGAATTCTGTACAACATGAGACCAAAAGAACTAGTGGA
GGTGATGAAAATGGCCTACCAGCAGGGGGAGGCAGAGTTT
GAGGATGAGGAACAGGAGAATGGAGAGGATCATGCAGCAT
CGCCTCGCAATGTTGGACACAACATCTATATTCTTGCACA
TCAGCTGTCGCGTCACAATAAGGAATTGCAAATACTACTG
AAACCAGGTGGAGAGGACCAGGCCCTGGAGTATTACACAA
AACACACCTCACAGATAGAGATAGTTCGACAGGATCGCAC
TATGGAACAGATTGTGTTTCCTGTACCAAATATCTGCTCT
TTTCTGACAAATGAGTCCAAGCTGCGTGTGTACTATGGTA
CAGAGAGAGACGAGCAAGGCAGTAAAATAAATGACTTCTT
CTTGCATGCAGACGACCTCTTTAATGAAATGAGGTGGCAG
AAAAAACTAAGAGCTCAGCCAGTGCTGTACTGGTGCAGCA
GGAACATGTCGTTTTGGAGTAACGTTTCCTTTAATCTGGC
GGTGCTCATTAATTTGCTGGTGGCATTTTTCTACCCTCTG
GATGGAGTGAGCGAAAGCCAGCTGGAACCTTCTCTGTCTC
TGTTGCTGTGGGTTTGTTTGTTGGGCTCACTGGGCTTCGT
GTTGATGTCCCCGAGGCCAAATGCAGTGCGGGTGCTGGTC
ATCTCCACTGTCCTGCAGTTGGGCTTCTCTGTAGGGCTGC
AGCACATGCTCACACTCCTGGGAGCTTTCAATGTTTGTAA
TAAGATCGTGTTCATGCTGAGCTTTGTGGGTAACCGTGGG
TCATTCACCCGGGGTTATCGGGTGATGGTCATGGATAGAG
AGTTCCTGTTTCATCTGCTGTACCTTCTCATCTGCATACT
GGGCCTTTTTGGACACGTCTTCTTTTACAGTCTTCTGTTG
TTTGACCTGGTGAACCGGGAAGAGACTCTTCTGAACGTCA
TCAAGAGTGTGACTCGAAACGGCCGCTCCATCGTCTTGAC
CGCAGTGCTGGGCCTCATCCTGGTCTACCTCTTTTCTATT
GTTGGATATATGTTTTTCAAAGATGACTTCATCCTGGAGG
TGAACCGCATCTCCAACGGCACTCTGGAGGAGGGGGTGAC
TTTACCTGCTGGTTTTTGTGATGCGAGAAACGGGTCGTGT
CTTTCTGATGATGTTGACGAGGATGACGTGGAGCGCGCGT
GTGATTCTCTATGGATGTGTATGATCACTGTACTCAGTCA
TGGCCTCAGGAGCGGTGGAGGAGTTGGAGATGTCCTGCGC
AAACCGTCTAAAGAGGAGCGTCTGTTCGCCGCACGGGTGG
TGTACGATCTCCTGTTCTTCTTCCTGGTGATCATCATTGT
GTTGAATCTGATCTTCGGTGTGATCATTGACACATTTGCA
GATCTGAGAAGCGAGAAGCAGAGAAAAGAGGAGATCTTGA
AGACCACATGCTTCATCTGTGGTCTGGAGAGAGATAAGTT
TGATAATAAAACGGTGACGTTTGAAGAGCACATCAAGGAG
GAGCACAACCTGTGGCATTACCTCTTCTTCATAGTGCTGG
TGCGGGTCAAAGACTCCACCGAATACACGGGACCCGAGAG
CTACGTCGCTCAGATGATCAAGGAGCACAATCTGGACTGG
TTTCCTCGTATGAGGGCGATGTCTCTGGTCAGCAGTGATG
GAGAAGGTGAACAGAATGAACTGCGCAGCTTACAGGAGAA
ACTCGAGTCCACAATGAGGCTCGTCTCTAATCTTACCAAT
CAGCTCACAGAGCTCAAAGAGCAGATGACTGAGCAAAGGA
AACACAAGCAGAGGCTCGGTCTGCTGGGAAACCCCGCCCA
CCTCAACATCAACCCACAGCAGCCAGCATGAGGTGGGTGG
AGTCTGAGGCCTCCAAGCCATCACAGCCTTTAAAACCTGA
TGTTGTATCTTGTTAATACAAACTCCAATATGGTCATGTC
TGGTCATACTTGGACATGTACACAGTCAAGGACTCGAGTA
ATGATATTTTGAGCCTCATCGCGCTATGAGGTGCTATATA
TTATTTTTTTAAGCACTGATGTGATCACTTCACAAACAAT
CTTTGCACTGTTTGAGTTGGGGTGTGCGATATTTATTGTC
AACATCAATTTTTACATCATTTGTTACAAATTTGAATAAT
GTTTGAGCTGAAGTGAATGATTCACACATTTATACTGATT
TCATACAGAAGTTCAACAAACAGCAAGTTGATGTTGAATT
TTTGTACCTTTTAAAGACAAGTTTTTCAGTCAACAAGGAA
TATTTTCAAACAAAACCAAAGCAGAATAATGGTGCATCTC
TGAGAAACACTGCTGTGTTTCTTTTCTGAATGAATCTGTT
TTTGAAAGAATCATTTGAGTTACTGATTCATTCATTTTAC
TTCAGCTTAGTCCCTTTATTTATCAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations