Transcript

p2rx3b-002

ID
ZDB-TSCRIPT-110325-1185
Name
p2rx3b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048558 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048558|OTTDARG00000019475|ZDB-GENE-030319-3 p2rx3b|no_translation p2rx3b-002 LG_ BX511158.5 Danio rerio protein_coding KNOWN, 759 bp
TTGAAGGGCATTTTTGTTCATTTTGGTGCTATTTTTCTCT
TTAGACCTCTTCAATATACAATCTGAGTCCACATACACAG
TCCAAGCTAATTTCTAGAGTGTAAAACTGTACAAAGTTTT
ATAATGGACACATACTGTAGTATTAAATATTAAAAGGCAT
TTAAAAAGACACTAATTTAATTAAAGCTTTAGGTTGGATA
ATCTGAATTTAAACCATATCTGCTATTGTGTCTAAATCTT
TAAAATCAGGTACGCTAAGTATTTTAAAATGGAGAACGGA
ACTGAGTATCGCACTCTGCTGAAAGCCTACGCCATCAGAT
TTGATGTGCTGGTCAATGGAGATGCAGGAAAATTTGACAT
GATCCCAACTCTAATCAACATGGTGGCTGCTTTCACCTCT
GTTGGTGTGGGTACAGTGCTTTGCGATATCATTTTGCTGA
ACTTCTTGAAAGGAGCAGACCAATATAAGGCCAAGAAATT
TGAAGAGGTGTCAGATTCAAATATTCAAAGCTCTGGTTCA
CTGTACAGGACCAGAGACCACAGCCAGCAGTCCATCAAAA
CCGACGAGAAGTTCTCCAACGACTCCGGCGCCTTTTCCAT
CGAACGTTACAGCTAATAATGCTAATCACAGGATTGAAAT
GAGTCGATTTGTAACATTATCATTTCTTCATCAAGTCATC
GCACTTAATAATCTTTGTCATTGTCATTAATGATTTAGCA
TTATTTTGAACTAACCCTTAAACTTTACACACAAAACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations